Rab9 (RAB9A) (NM_001195328) Human Untagged Clone

SKU
SC329453
RAB9A (untagged) - Homo sapiens RAB9A, member RAS oncogene family (RAB9A), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Rab9
Synonyms RAB9
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC329453 representing NM_001195328.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGGAAAATCATCACTTTTTAAAGTAATTCTCCTTGGAGATGGTGGAGTTGGGAAGAGTTCACTT
ATGAACAGATATGTAACTAATAAGTTTGATACCCAGCTCTTCCATACAATAGGTGTGGAATTTTTAAAT
AAAGATTTGGAAGTGGATGGACATTTTGTTACCATGCAGATTTGGGACACGGCAGGTCAGGAGCGATTC
CGAAGCCTGAGGACACCATTTTACAGAGGTTCTGACTGCTGCCTGCTTACTTTTAGTGTCGATGATTCA
CAAAGCTTCCAGAACTTAAGTAACTGGAAGAAAGAATTCATATATTATGCAGATGTGAAAGAGCCTGAG
AGCTTTCCTTTTGTGATTCTGGGTAACAAGATTGACATAAGCGAACGGCAGGTGTCTACAGAAGAAGCC
CAAGCTTGGTGCAGGGACAACGGCGACTATCCTTATTTTGAAACAAGTGCAAAAGATGCCACAAATGTG
GCAGCAGCCTTTGAGGAAGCGGTTCGAAGAGTTCTTGCTACCGAGGATAGGTCAGATCATTTGATTCAG
ACAGACACAGTCAATCTTCACCGAAAGCCCAAGCCTAGCTCATCTTGCTGTTGA

Restriction Sites SgfI-MluI
ACCN NM_001195328
Insert Size 606 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001195328.1
RefSeq Size 1288 bp
RefSeq ORF 606 bp
Locus ID 9367
UniProt ID P51151
Cytogenetics Xp22.2
Protein Families Druggable Genome
MW 22.8 kDa
Summary Involved in the transport of proteins between the endosomes and the trans Golgi network. Involved in the recruitment of SGSM2 to melanosomes and is required for the proper trafficking of melanogenic enzymes TYR, TYRP1 and DCT/TYRP2 to melanosomes in melanocytes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.
Write Your Own Review
You're reviewing:Rab9 (RAB9A) (NM_001195328) Human Untagged Clone
Your Rating
SKU Description Size Price
RC232102 RAB9A (Myc-DDK tagged) - Homo sapiens RAB9A, member RAS oncogene family (RAB9A), transcript variant 2 10 ug
$480.00
RG232102 RAB9A (tGFP-tagged) - Homo sapiens RAB9A, member RAS oncogene family (RAB9A), transcript variant 2 10 ug
$680.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.