Rab9 (RAB9A) (NM_001195328) Human Untagged Clone
SKU
SC329453
RAB9A (untagged) - Homo sapiens RAB9A, member RAS oncogene family (RAB9A), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Rab9 |
Synonyms | RAB9 |
Vector | pCMV6-Entry |
Sequence Data |
Fully Sequenced ORF
>SC329453 representing NM_001195328.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCAGGAAAATCATCACTTTTTAAAGTAATTCTCCTTGGAGATGGTGGAGTTGGGAAGAGTTCACTT ATGAACAGATATGTAACTAATAAGTTTGATACCCAGCTCTTCCATACAATAGGTGTGGAATTTTTAAAT AAAGATTTGGAAGTGGATGGACATTTTGTTACCATGCAGATTTGGGACACGGCAGGTCAGGAGCGATTC CGAAGCCTGAGGACACCATTTTACAGAGGTTCTGACTGCTGCCTGCTTACTTTTAGTGTCGATGATTCA CAAAGCTTCCAGAACTTAAGTAACTGGAAGAAAGAATTCATATATTATGCAGATGTGAAAGAGCCTGAG AGCTTTCCTTTTGTGATTCTGGGTAACAAGATTGACATAAGCGAACGGCAGGTGTCTACAGAAGAAGCC CAAGCTTGGTGCAGGGACAACGGCGACTATCCTTATTTTGAAACAAGTGCAAAAGATGCCACAAATGTG GCAGCAGCCTTTGAGGAAGCGGTTCGAAGAGTTCTTGCTACCGAGGATAGGTCAGATCATTTGATTCAG ACAGACACAGTCAATCTTCACCGAAAGCCCAAGCCTAGCTCATCTTGCTGTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001195328 |
Insert Size | 606 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001195328.1 |
RefSeq Size | 1288 bp |
RefSeq ORF | 606 bp |
Locus ID | 9367 |
UniProt ID | P51151 |
Cytogenetics | Xp22.2 |
Protein Families | Druggable Genome |
MW | 22.8 kDa |
Summary | Involved in the transport of proteins between the endosomes and the trans Golgi network. Involved in the recruitment of SGSM2 to melanosomes and is required for the proper trafficking of melanogenic enzymes TYR, TYRP1 and DCT/TYRP2 to melanosomes in melanocytes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.