p53 (TP53) (NM_001126118) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | p53 |
Synonyms | BCC7; BMFS5; LFS1; P53; TRP53 |
Vector | pCMV6-Entry |
Sequence Data |
Fully Sequenced ORF
>SC329409 representing NM_001126118.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAA GCTCCCAGAATGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCT GCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGT TTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAAC AAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGC ACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCC CACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAAT TTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCT GAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATG AACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGC TTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAA GGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCT CCCCAGCCAAAGAAGAAACCACTGGATGGAGAATATTTCACCCTTCAGATCCGTGGGCGTGAGCGCTTC GAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGG AGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATG TTCAAGACAGAAGGGCCTGACTCAGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001126118 |
Insert Size | 1065 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001126118.1 |
RefSeq Size | 2708 bp |
RefSeq ORF | 1065 bp |
Locus ID | 7157 |
UniProt ID | P04637 |
Cytogenetics | 17p13.1 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
Protein Pathways | Amyotrophic lateral sclerosis (ALS), Apoptosis, Basal cell carcinoma, Bladder cancer, Cell cycle, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, Glioma, Huntington's disease, MAPK signaling pathway, Melanoma, Neurotrophin signaling pathway, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Pathways in cancer, Prostate cancer, Small cell lung cancer, Thyroid cancer, Wnt signaling pathway |
MW | 39.3 kDa |
Summary | This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016] Transcript Variant: This variant (8, also known as p53I2) differs in the 5' UTR, and uses an in-frame downstream start codon, compared to variant 1. The encoded isoform (g, also known as delta40p53alpha or deltaNp53) has a shorter N-terminus, compared to isoform a. This variant is supported by data in PMID:21112961. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.