FBXL2 (NM_001171713) Human Untagged Clone
SKU
SC328567
FBXL2 (untagged)-Human F-box and leucine-rich repeat protein 2 (FBXL2) transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | FBXL2 |
Synonyms | FBL2; FBL3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC328567 representing NM_001171713.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTTTTCTCAAACAATGATGAAGGCCTTATTAACAAAAAGTTACCCAAAGAACTTCTGTTAAGAATA TTTTCCTTCTTGGATATAGTAACTTTGTGCCGATGTGCACAGATTTCCAAGGCTTGGAACATCTTAGCC CTGGATGGAAGCAACTGGCAAAGAATAGATCTTTTTAACTTTCAAACAGATGTAGAGGGTCGAGTGGTG GAAAATATCTCGAAGCGATGCGGTGGATTCCTGAGGAAGCTCAGCTTGCGAGGCTGCATTGGTGTTGGG GATTCCTCCTTGAAGACCTTTGCACAGAACTGCCGAAACATTGAACATTTGAACCTCAATGGATGCACA AAAATCACTGACAGCACGTGTTATAGCCTTAGCAGATTCTGTTCCAAGCTGAAACACATTCAGAATTAC TGCCATGAGCTTGTGAGCCTCAACTTGCAGTCCTGCTCACGTATCACGGATGAAGGTGTGGTGCAGATA TGCAGGGGCTGTCACCGGCTACAGGCTCTCTGCCTTTCGGGTTGCAGCAACCTCACAGATGCCTCTCTT ACAGCCCTGGGTTTGAACTGTCCGCGACTGCAAATTTTGGAGGCTGCCCGATGCTCCCATTTGACTGAC GCAGGTTTTACACTTTTAGCTCGGAATTGCCACGAATTGGAGAAGATGGATCTTGAAGAATGCATCCTG ATAACCGACAGCACACTCATCCAGCTCTCCATTCACTGTCCTAAACTGCAAGCCCTGAGCCTGTCCCAC TGTGAACTCATCACAGATGATGGGATCCTGCACCTGAGCAACAGTACCTGTGGCCATGAGAGGCTGCGG GTACTGGAGTTGGACAACTGCCTCCTCATCACTGATGTGGCCCTGGAACACCTAGAGAACTGCCGAGGC CTGGAGCGCCTCGAGCTGTACGACTGCCAGCAGGTTACCCGTGCAGGCATCAAGCGGATGCGGGCTCAG CTCCCTCATGTCAAAGTCCACGCCTACTTTGCTCCCGTCACCCCACCGACAGCAGTGGCAGGAAGTGGA CAGCGACTGTGCAGGTGCTGTGTCATTCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001171713 |
Insert Size | 1068 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001171713.1 |
RefSeq Size | 2793 bp |
RefSeq ORF | 1068 bp |
Locus ID | 25827 |
UniProt ID | Q9UKC9 |
Cytogenetics | 3p22.3 |
Protein Families | Druggable Genome |
MW | 39.6 kDa |
Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 12 tandem leucine-rich repeats. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (2) encodes isoform 2. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC229929 | FBXL2 (Myc-DDK-tagged)-Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2 | 10 ug |
$457.00
|
|
RC229929L1 | Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC229929L2 | Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RC229929L3 | Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC229929L4 | Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RG229929 | FBXL2 (tGFP-tagged) - Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2 | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.