FBXL2 (NM_001171713) Human Untagged Clone

SKU
SC328567
FBXL2 (untagged)-Human F-box and leucine-rich repeat protein 2 (FBXL2) transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FBXL2
Synonyms FBL2; FBL3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328567 representing NM_001171713.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTTTTCTCAAACAATGATGAAGGCCTTATTAACAAAAAGTTACCCAAAGAACTTCTGTTAAGAATA
TTTTCCTTCTTGGATATAGTAACTTTGTGCCGATGTGCACAGATTTCCAAGGCTTGGAACATCTTAGCC
CTGGATGGAAGCAACTGGCAAAGAATAGATCTTTTTAACTTTCAAACAGATGTAGAGGGTCGAGTGGTG
GAAAATATCTCGAAGCGATGCGGTGGATTCCTGAGGAAGCTCAGCTTGCGAGGCTGCATTGGTGTTGGG
GATTCCTCCTTGAAGACCTTTGCACAGAACTGCCGAAACATTGAACATTTGAACCTCAATGGATGCACA
AAAATCACTGACAGCACGTGTTATAGCCTTAGCAGATTCTGTTCCAAGCTGAAACACATTCAGAATTAC
TGCCATGAGCTTGTGAGCCTCAACTTGCAGTCCTGCTCACGTATCACGGATGAAGGTGTGGTGCAGATA
TGCAGGGGCTGTCACCGGCTACAGGCTCTCTGCCTTTCGGGTTGCAGCAACCTCACAGATGCCTCTCTT
ACAGCCCTGGGTTTGAACTGTCCGCGACTGCAAATTTTGGAGGCTGCCCGATGCTCCCATTTGACTGAC
GCAGGTTTTACACTTTTAGCTCGGAATTGCCACGAATTGGAGAAGATGGATCTTGAAGAATGCATCCTG
ATAACCGACAGCACACTCATCCAGCTCTCCATTCACTGTCCTAAACTGCAAGCCCTGAGCCTGTCCCAC
TGTGAACTCATCACAGATGATGGGATCCTGCACCTGAGCAACAGTACCTGTGGCCATGAGAGGCTGCGG
GTACTGGAGTTGGACAACTGCCTCCTCATCACTGATGTGGCCCTGGAACACCTAGAGAACTGCCGAGGC
CTGGAGCGCCTCGAGCTGTACGACTGCCAGCAGGTTACCCGTGCAGGCATCAAGCGGATGCGGGCTCAG
CTCCCTCATGTCAAAGTCCACGCCTACTTTGCTCCCGTCACCCCACCGACAGCAGTGGCAGGAAGTGGA
CAGCGACTGTGCAGGTGCTGTGTCATTCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001171713
Insert Size 1068 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001171713.1
RefSeq Size 2793 bp
RefSeq ORF 1068 bp
Locus ID 25827
UniProt ID Q9UKC9
Cytogenetics 3p22.3
Protein Families Druggable Genome
MW 39.6 kDa
Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 12 tandem leucine-rich repeats. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (2) encodes isoform 2.
Write Your Own Review
You're reviewing:FBXL2 (NM_001171713) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229929 FBXL2 (Myc-DDK-tagged)-Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2 10 ug
$457.00
RC229929L1 Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC229929L2 Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, mGFP tagged 10 ug
$757.00
RC229929L3 Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC229929L4 Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG229929 FBXL2 (tGFP-tagged) - Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.