PDHB (NM_001173468) Human Untagged Clone
SKU
SC328545
PDHB (untagged)-Human pyruvate dehydrogenase (lipoamide) beta (PDHB) nuclear gene encoding mitochondrial protein transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PDHB |
Synonyms | PDHBD; PDHE1-B; PDHE1B; PHE1B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC328545 representing NM_001173468.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTCTCCGGGCTGCTGAAGAGGCGCTTT CACTGGACCGCGCCGGCTGCGCTGCAGGTGACAGTTCGTGATGCTATAAATCAGGGTATGGATGAGGAG CTGGAAAGAGATGAGAAGGTATTTCTGCTTGGAGAAGAAGTTGCCCAGTATGATGGGGCATACAAGGTT AGTCGAGGGCTGTGGAAGAAATATGGAGACAAGAGGATTATTGACACTCCCATATCAGAGATGGGCTTT GCTGGAATTGCTGTAGGTGCAGCTATGGCTGGGTTGCGGCCCATTTGTGAATTTATGACCTTCAATTTC TCCATGCAAGCCATTGACCAGGTTATAAACTCAGCTGCCAAGACCTACTACATGTCTGGTGTAGCTGCC CAGCACTCACAGTGCTTTGCTGCCTGGTATGGGCACTGCCCAGGCTTAAAGGTGGTCAGTCCCTGGAAT TCAGAGGATGCTAAAGGACTTATTAAATCAGCCATTCGGGATAACAATCCAGTGGTGGTGCTAGAGAAT GAATTGATGTATGGGGTTCCTTTTGAATTTCCTCCGGAAGCTCAGTCAAAAGATTTTCTGATTCCTATT GGAAAAGCCAAAATAGAAAGGCAAGGAACACATATAACTGTGGTTTCCCATTCAAGACCTGTGGGCCAC TGCTTAGAAGCTGCAGCAGTGCTATCTAAAGAAGGAGTTGAATGTGAGGTGATAAATATGCGTACCATT AGACCAATGGACATGGAAACCATAGAAGCCAGTGTCATGAAGACAAATCATCTTGTAACTGTGGAAGGA GGCTGGCCACAGTTTGGAGTAGGAGCTGAAATCTGTGCCAGGATCATGGAAGGTCCTGCGTTCAATTTC CTGGATGCTCCTGCTGTTCGTGTCACTGGTGCTGATGTCCCTATGCCTTATGCAAAGATTCTAGAGGAC AACTCTATACCTCAGGTCAAAGACATCATATTTGCAATAAAGAAAACATTAAATATTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001173468 |
Insert Size | 1026 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001173468.1 |
RefSeq Size | 1490 bp |
RefSeq ORF | 1026 bp |
Locus ID | 5162 |
UniProt ID | P11177 |
Cytogenetics | 3p14.3 |
Protein Pathways | Butanoate metabolism, Citrate cycle (TCA cycle), Glycolysis / Gluconeogenesis, leucine and isoleucine biosynthesis, Metabolic pathways, Pyruvate metabolism, Valine |
MW | 37.5 kDa |
Summary | The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and carbon dioxide, and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 beta subunit. Mutations in this gene are associated with pyruvate dehydrogenase E1-beta deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (2) lacks a segment in the coding region compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC229907 | PDHB (Myc-DDK-tagged)-Human pyruvate dehydrogenase (lipoamide) beta (PDHB), nuclear gene encoding mitochondrial protein, transcript variant 2 | 10 ug |
$457.00
|
|
RC229907L3 | Lenti ORF clone of Human pyruvate dehydrogenase (lipoamide) beta (PDHB), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC229907L4 | Lenti ORF clone of Human pyruvate dehydrogenase (lipoamide) beta (PDHB), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RG229907 | PDHB (tGFP-tagged) - Human pyruvate dehydrogenase (lipoamide) beta (PDHB), nuclear gene encoding mitochondrial protein, transcript variant 2 | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.