TSSK4 (NM_001184739) Human Untagged Clone

SKU
SC328543
TSSK4 (untagged)-Human testis-specific serine kinase 4 (TSSK4) transcript variant 1
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TSSK4
Synonyms C14orf20; STK22E; TSK-4; TSK4; TSSK5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328543 representing NM_001184739.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAAGGGAGATGTCTTAGAGGCAGCACCAACCACCACAGCCTACCATTCCCTCATGGATGAATAT
GGTTATGAGGTGGGCAAGGCCATTGGCCATGGCTCCTATGGGTCGGTATATGAGGCTTTCTACACAAAG
CAGAAGGTTATGGTGGCAGTCAAGATCATCTCAAAGAAGAAGGCCTCTGATGACTATCTTAACAAGTTC
CTGCCCCGTGAAATACAGGTAATGAAAGTCTTGCGGCACAAGTACCTCATCAACTTCTATCGGGCCATT
GAGAGCACATCTCGAGTATACATCATTCTGGAACTGGCTCAGGGTGGTGATGTCCTTGAATGGATCCAG
CGCTACGGGGCCTGCTCTGAGCCCCTTGCTGGCAAGTGGTTCTCCCAGCTGACCCTGGGCATTGCCTAC
CTGCACAGCAAGAGCATCGTGCACCGCCTGATGCCCAGCCTTTCTGCTGCTGGTAGGGACTTAAAGTTG
GAGAACCTGTTGCTGGACAAGTGGGAGAATGTGAAGATATCAGACTTTGGCTTTGCCAAGATGGTGCCT
TCTAACCAGCCTGTGGGTTGTAGCCCTTCTTACCGCCAAGTGAACTGCTTTTCCCACCTCAGCCAGACT
TACTGTGGCAGCTTTGCTTACGCTTGCCCAGAGATCTTACGAGGCTTGCCCTACAACCCTTTCCTGTCT
GACACCTGGAGCATGGGCGTCATCCTTTACACTCTAGTGGTCGCCCATCTGCCCTTTGATGACACCAAT
CTCAAAAAGCTGCTAAGAGAGACTCAGAAGGAGGTCACTTTCCCAGCTAACCATACCATCTCCCAGGAG
TGCAAGAACCTGATCCTCCAGATGCTACGCCAAGCCACTAAGCGTGCCACCATTCTGGACATCATCAAG
GATTCCTGGGTGCTCAAGTTCCAGCCTGAGCAACCCACCCATGAGATCAGGCTGCTTGAGGCCATGTGC
CAGCTCCACAACACCACTAAACAGCACCAATCCTTGCAAATTACGACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001184739
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001184739.1
RefSeq Size 1330 bp
RefSeq ORF 1017 bp
Locus ID 283629
UniProt ID Q6SA08
Cytogenetics 14q12
Protein Families Druggable Genome, Protein Kinase
MW 38.4 kDa
Summary This gene encodes a member of the testis-specific serine/threonine kinase family. The encoded protein is thought to be involved in spermatogenesis via stimulation of the CREB/CRE responsive pathway through phosphorylation of the cAMP responsive element binding protein transcription factor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:TSSK4 (NM_001184739) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229905 TSSK4 (Myc-DDK-tagged)-Human testis-specific serine kinase 4 (TSSK4), transcript variant 1 10 ug
$457.00
RC229905L3 Lenti ORF clone of Human testis-specific serine kinase 4 (TSSK4), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC229905L4 Lenti ORF clone of Human testis-specific serine kinase 4 (TSSK4), transcript variant 1, mGFP tagged 10 ug
$757.00
RG229905 TSSK4 (tGFP-tagged) - Human testis-specific serine kinase 4 (TSSK4), transcript variant 1 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.