CYB5R3 (NM_001171660) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CYB5R3 |
Synonyms | B5R; DIA1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC328540 representing NM_001171660.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAATAGGAGTTTGCTGGTTGGATGCATGCAGAGCAAGGACATTTGGGGCAGAGAGGAGAGCATATGC GAACGCCTGAAGCAAGATGGGCTTGATGTTGAAAGAGCAGAGAGCTGGGAGTTGGGCCATATGGTGCTC TTCCCAGTCTGGTTCCTGTACAGTCTGCTCATGAAGCTGTTCCAGCGCTCCACGCCAGCCATCACCCTC GAGAGCCCGGACATCAAGTACCCGCTGCGGCTCATCGACCGGGAGATCATCAGCCATGACACCCGGCGC TTCCGCTTTGCCCTGCCGTCACCCCAGCACATCCTGGGCCTCCCTGTCGGCCAGCACATCTACCTCTCG GCTCGAATTGATGGAAACCTGGTCGTCCGGCCCTATACACCCATCTCCAGCGATGATGACAAGGGCTTC GTGGACCTGGTCATCAAGGTTTACTTCAAGGACACCCATCCCAAGTTTCCCGCTGGAGGGAAGATGTCT CAGTACCTGGAGAGCATGCAGATTGGAGACACCATTGAGTTCCGGGGCCCCAGTGGGCTGCTGGTCTAC CAGGGCAAAGGGAAGTTCGCCATCCGACCTGACAAAAAGTCCAACCCTATCATCAGGACAGTGAAGTCT GTGGGCATGATCGCGGGAGGGACAGGCATCACCCCGATGCTGCAGGTGATCCGCGCCATCATGAAGGAC CCTGATGACCACACTGTGTGCCACCTGCTCTTTGCCAACCAGACCGAGAAGGACATCCTGCTGCGACCT GAGCTGGAGGAACTCAGGAACAAACATTCTGCACGCTTCAAGCTCTGGTACACGCTGGACAGAGCCCCT GAAGCCTGGGACTACGGCCAGGGCTTCGTGAATGAGGAGATGATCCGGGACCACCTTCCACCCCCAGAG GAGGAGCCGCTGGTGCTGATGTGTGGCCCCCCACCCATGATCCAGTACGCCTGCCTTCCCAACCTGGAC CACGTGGGCCACCCCACGGAGCGCTGCTTCGTCTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001171660 |
Insert Size | 1005 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001171660.1 |
RefSeq Size | 3063 bp |
RefSeq ORF | 1005 bp |
Locus ID | 1727 |
UniProt ID | P00387 |
Cytogenetics | 22q13.2 |
Protein Families | Druggable Genome |
Protein Pathways | Amino sugar and nucleotide sugar metabolism |
MW | 38.2 kDa |
Summary | This gene encodes cytochrome b5 reductase, which includes a membrane-bound form in somatic cells (anchored in the endoplasmic reticulum, mitochondrial and other membranes) and a soluble form in erythrocytes. The membrane-bound form exists mainly on the cytoplasmic side of the endoplasmic reticulum and functions in desaturation and elongation of fatty acids, in cholesterol biosynthesis, and in drug metabolism. The erythrocyte form is located in a soluble fraction of circulating erythrocytes and is involved in methemoglobin reduction. The membrane-bound form has both membrane-binding and catalytic domains, while the soluble form has only the catalytic domain. Alternate splicing results in multiple transcript variants. Mutations in this gene cause methemoglobinemias. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (5) differs in the 5' UTR and 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) is longer and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC229902 | CYB5R3 (Myc-DDK-tagged)-Human cytochrome b5 reductase 3 (CYB5R3), transcript variant 5 | 10 ug |
$457.00
|
|
RC229902L3 | Lenti ORF clone of Human cytochrome b5 reductase 3 (CYB5R3), transcript variant 5, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC229902L4 | Lenti ORF clone of Human cytochrome b5 reductase 3 (CYB5R3), transcript variant 5, mGFP tagged | 10 ug |
$757.00
|
|
RG229902 | CYB5R3 (tGFP-tagged) - Human cytochrome b5 reductase 3 (CYB5R3), transcript variant 5 | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.