GPR137 (NM_001177358) Human Untagged Clone

SKU
SC328525
GPR137 (untagged)-Human G protein-coupled receptor 137 (GPR137) transcript variant 5
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GPR137
Synonyms C11orf4; GPR137A; TM7SF1L1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328525 representing NM_001177358.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAGTAACCTGTCTGGCCTGGTGCCTGCTGCCGGGCTGGTGCCTGCGCTGCCACCTGCTGTGACC
CTGGGGCTGACAGCTGCCTACACCACCCTGTATGCCCTGCTCTTCTTCTCCGTCTATGCCCAGCTCTGG
CTGGTGCTTCTGTATGGGCACAAGCGTCTCAGCTATCAGACGGTGTTCCTGGCCCTCTGTCTGCTCTGG
GCCGCCTTGCGTACCACCCTCTTCTCCTTCTACTTCCGAGATACTCCCCGCGCCAACCGCCTGGGGCCC
TTGCCCTTCTGGCTTCTCTACTGCTGCCCCGTCTGCCTGCAGTTCTTCACCTTGACGCTTATGAACCTC
TACTTTGCCCAGGTGGTGTTCAAGGCCAAGGTGAAGCGTCGGCCGGAGATGAGCCGAGGCTTGCTCGCT
GTCCGAGGGGCCTTTGTGGGGGCCTCGCTGCTCTTTCTGCTGGTGAACGTGCTGTGTGCTGTGCTCTCC
CATCGGCGCCGGGCACAGCCCTGGGCCCTGCTGCTTGTCCGCGTCCTGGTGAGCGACTCCCTGTTCGTC
ATCTGCGCGCTGTCTCTTGCTGCCTGCCTCTGCCTCGTCGCCAGGCGGGCGCCCTCCACTAGCATCTAC
CTGGAGGCCAAGGGGACCAGTGTGTGCCAGGCGGCCGCGATGGGTGGCGCCATGGTCCTGCTCTATGCC
AGCCGGGCCTGCTACAACCTGACAGCACTGGCCTTGGCCCCCCAGAGCCGGCTGGACACCTTCGATTAC
GACTGGTACAATGTGTCTGACCAGGCGGACCTGGTGAATGACCTGGGGAACAAAGGCTACCTGGTATTT
GGCCTCATCCTCTTCGTGTGGGAGCTACTGCCCACCACCCTGCTGGTGGGCTTCTTCCGGGTGCACCGG
CCCCCACAGGACCTGTATGTCGGGCAGTCTAGGCTCTGGGAGCTGGTATGGTGCCATCGGGCGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001177358
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001177358.1
RefSeq Size 1861 bp
RefSeq ORF 963 bp
Locus ID 56834
UniProt ID Q96N19
Cytogenetics 11q13.1
Protein Families Druggable Genome, Transmembrane
MW 35.8 kDa
Summary Lysosomal integral membrane protein that may regulate MTORC1 complex translocation to lysosomes (PubMed:31036939). May play a role in autophagy (PubMed:31036939).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR and has multiple coding region differences, compared to variant 1, one of which results in a frameshift. The resulting protein (isoform 5) includes an alternate segment and has a shorter and distinct C-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:GPR137 (NM_001177358) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229887 GPR137 (Myc-DDK-tagged)-Human G protein-coupled receptor 137 (GPR137), transcript variant 5 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC229887L3 Lenti ORF clone of Human G protein-coupled receptor 137 (GPR137), transcript variant 5, Myc-DDK-tagged 10 ug
$600.00
RC229887L4 Lenti ORF clone of Human G protein-coupled receptor 137 (GPR137), transcript variant 5, mGFP tagged 10 ug
$600.00
RG229887 GPR137 (tGFP-tagged) - Human G protein-coupled receptor 137 (GPR137), transcript variant 5 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.