ZFYVE27 (NM_001174120) Human Untagged Clone

SKU
SC328515
ZFYVE27 (untagged)-Human zinc finger FYVE domain containing 27 (ZFYVE27) transcript variant 5
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ZFYVE27
Synonyms PROTRUDIN; SPG33
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328515 representing NM_001174120.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGACATCAGAACGTGAGGGGAGTGGGCCGGAGCTGAGCCCCAGCGTGATGCCCGAGGCTCCCCTG
GAGTCTCCACCTTTTCCTACCAAGTCCCCAGCGTTTGACCTTTTCAACTTGGTTCTCTCCTACAAGAGG
CTGGAGATCTACCTGGAACCCTTGAAGGATGCAGGTGATGGTGTTCGATACTTGCTCAGCTTGATCCAG
CTGGAGGCCTTCCTGAGCCGCCTGTGCTGCACATGTGAAGCCGCCTACCGCGTGCTGCACTGGGAGAAC
CCCGTCGTGTCCTCACAGTTCTATGGGGCTCTTCTGGGCACAGTCTGCATGCTGTATTTGCTGCCACTC
TGCTGGGTTCTCACCCTTTTAAACAGCACGCTCTTTCTGGGGAATGTGGAGTTCTTCCGAGTTGTGTCT
GAGTACAGGGCATCTCTGCAGCAGAGGATGAACCCAAAGCAGGAAGAGCATGCCTTTGAGAGTCCTCCA
CCACCAGATGTTGGGGGGAAGGATGGTCTGATGGACAGCACGCCTGCCCTCACACCCACGGAGGACCTC
ACACCGGGCAGCGTGGAGGAGGCTGAGGAGGCTGAGCCAGATGAAGAGTTTAAAGATGCGATTGAGGAG
GATGATGAGGGCGCCCCGTGCCCAGCAGAGGATGAGCTGGCCCTGCAGGACAACGGGTTCCTGAGCAAG
AATGAGGTGCTGCGCAGCAAGGTGTCTCGGCTCACGGAGCGGCTCCGCAAGCGCTACCCCACCAACAAC
TTCGGGAACTGCACGGGCTGCTCGGCCACCTTCTCAGTGCTGAAGAAGAGGCGGAGCTGCAGTAATTGT
GGAAACAGCTTCTGCTCTCGATGCTGCTCCTTCAAGGTGCCCAAGTCCTCCATGGGGGCCACAGCCCCT
GAAGCCCAGAGGGAGACTGTGTTTGTGTGTGCCTCGTGTAACCAGACCTTGAGCAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001174120
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001174120.1
RefSeq Size 2776 bp
RefSeq ORF 957 bp
Locus ID 118813
UniProt ID Q5T4F4
Cytogenetics 10q24.2
Protein Families Transmembrane
MW 35.2 kDa
Summary This gene encodes a protein with several transmembrane domains, a Rab11-binding domain and a lipid-binding FYVE finger domain. The encoded protein appears to promote neurite formation. A mutation in this gene has been reported to be associated with hereditary spastic paraplegia, however the pathogenicity of the mutation, which may simply represent a polymorphism, is unclear. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (5) differs in the 5' UTR, uses an alternate in-frame splice site, and lacks three in-frame alternate exons compared to variant 1. This results in a shorter protein (isoform e), compared to isoform a.
Write Your Own Review
You're reviewing:ZFYVE27 (NM_001174120) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229877 ZFYVE27 (Myc-DDK-tagged)-Human zinc finger, FYVE domain containing 27 (ZFYVE27), transcript variant 5 10 ug
$300.00
RC229877L3 Lenti ORF clone of Human zinc finger, FYVE domain containing 27 (ZFYVE27), transcript variant 5, Myc-DDK-tagged 10 ug
$600.00
RC229877L4 Lenti ORF clone of Human zinc finger, FYVE domain containing 27 (ZFYVE27), transcript variant 5, mGFP tagged 10 ug
$600.00
RG229877 ZFYVE27 (tGFP-tagged) - Human zinc finger, FYVE domain containing 27 (ZFYVE27), transcript variant 5 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.