MINPP1 (NM_001178117) Human Untagged Clone

SKU
SC328504
MINPP1 (untagged)-Human multiple inositol-polyphosphate phosphatase 1 (MINPP1) transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MINPP1
Synonyms HIPER1; MINPP2; MIPP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328504 representing NM_001178117.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTACGCGCGCCCGGCTGCCTCCTCCGGACCTCCGTAGCGCCTGCCGCGGCCCTGGCTGCGGCGCTG
CTCTCGTCGCTTGCGCGCTGCTCTCTTCTAGAGCCGAGGGACCCGGTGGCCTCGTCGCTCAGCCCCTAT
TTCGGCACCAAGACTCGCTACGAGGATGTCAACCCCGTGCTATTGTCGGGCCCCGAGGCTCCGTGGCGG
GACCCTGAGCTGCTGGAGGGGACCTGCACCCCGGTGCAGCTGGTCGCCCTCATTCGCCACGGCACCCGC
TACCCCACGGTCAAACAGATCCGCAAGCTGAGGCAGCTGCACGGGTTGCTGCAGGCCCGCGGGTCCAGG
GATGGCGGGGCTAGTAGTACCGGCAGCCGCGACCTGGGTGCAGCGCTGGCCGACTGGCCTTTGTGGTAC
GCGGACTGGATGGACGGGCAGCTAGTAGAGAAGGGACGGCAGGATATGCGACAGCTGGCGCTGCGTCTG
GCCTCGCTCTTCCCGGCCCTTTTCAGCCGTGAGAACTACGGCCGCCTGCGGCTCATCACCAGTTCCAAG
CACCGCTGCATGGATAGCAGCGCCGCCTTCCTGCAGGGGCTGTGGCAGCACTACCACCCTGGCTTGCCG
CCGCCGGACGTCGCAGATATGGAGTTTGGACCTCCAACAGTTAATGATAAACTAATGAGATTTTTTGAT
CACTGTGAGAAGTTTTTAACTGAAGTAGAAAAAAATGCTACAGCTCTTTATCACGTGGAAGCCTTCAAA
ACTGGACCAGAAATGCAGAACATTTTAAAAAAAGTTGCAGCTACTTTGCAAGTGCCAGTAAATGATTTA
AATGCAGGTCTCAGCCAATTTCTTCTCCAGTCATCCTCCAGTTTGGTCATGCAGAGACTCTTCTTCCAC
TGCTTTCTCTCATGGGCTACTTCAAAGACAAGGAACCCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001178117
Insert Size 939 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001178117.1
RefSeq Size 2674 bp
RefSeq ORF 939 bp
Locus ID 9562
UniProt ID Q9UNW1
Cytogenetics 10q23.2
Protein Families Druggable Genome
Protein Pathways Inositol phosphate metabolism
MW 34.7 kDa
Summary This gene encodes multiple inositol polyphosphate phosphatase; an enzyme that removes 3-phosphate from inositol phosphate substrates. It is the only enzyme known to hydrolzye inositol pentakisphosphate and inositol hexakisphosphate. This enzyme also converts 2,3 bisphosphoglycerate (2,3-BPG) to 2-phosphoglycerate; an activity formerly thought to be exclusive to 2,3-BPG synthase/2-phosphatase (BPGM) in the Rapoport-Luebering shunt of the glycolytic pathway.[provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) lacks two alternate coding exons compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:MINPP1 (NM_001178117) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229866 MINPP1 (Myc-DDK-tagged)-Human multiple inositol-polyphosphate phosphatase 1 (MINPP1), transcript variant 2 10 ug
$300.00
RC229866L3 Lenti ORF clone of Human multiple inositol-polyphosphate phosphatase 1 (MINPP1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC229866L4 Lenti ORF clone of Human multiple inositol-polyphosphate phosphatase 1 (MINPP1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG229866 MINPP1 (tGFP-tagged) - Human multiple inositol-polyphosphate phosphatase 1 (MINPP1), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.