PGAM5 (NM_001170543) Human Untagged Clone

SKU
SC328478
PGAM5 (untagged)-Human phosphoglycerate mutase family member 5 (PGAM5) nuclear gene encoding mitochondrial protein transcript variant 1
$450.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PGAM5
Synonyms BXLBV68
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001170543, the custom clone sequence may differ by one or more nucleotides


ATGGCGTTCCGGCAGGCGCTGCAGCTGGCGGCCTGCGGGCTGGCCGGGGGCTCGGCCGCCGTGCTCTTCT
CGGCCGTGGCGGTAGGGAAGCCGCGCGCAGGCGGGGACGCGGAGCCACGCCCGGCTGAGCCGCCGGCCTG
GGCGGGGGGCGCGCGGCCGGGCCCCGGTGTCTGGGACCCCAACTGGGACAGGCGAGAACCACTGTCTCTG
ATCAACGTGCGGAAGAGGAACGTGGAATCTGGGGAAGAAGAGCTGGCGTCCAAGCTGGACCACTACAAAG
CCAAGGCCACGCGGCACATCTTCCTCATCAGGCATTCCCAGTACCACGTGGATGGCTCCCTGGAGAAGGA
CCGCACTCTGACCCCGCTGGGTCGGGAGCAGGCTGAACTCACTGGGCTCCGCCTGGCAAGCTTGGGGTTG
AAGTTTAATAAAATCGTCCATTCGTCTATGACGCGCGCCATAGAGACCACCGATATCATCAGCCGGCACC
TGCCAGGCGTCTGCAAAGTCAGCACAGATCTGCTGCGGGAAGGCGCCCCCATCGAGCCAGACCCGCCCGT
GTCTCATTGGAAGCCGGAAGCTGTGCAGTATTACGAAGACGGAGCCCGGATCGAGGCCGCCTTCCGGAAC
TACATCCACCGCGCAGATGCCAGGCAGGAGGAGGACAGTTACGAGATCTTCATCTGTCACGCCAACGTCA
TCCGCTACATCGTGTGCAGAGCACTGCAGTTTCCTCCTGAAGGCTGGCTCCGGCTCTCCCTCAATAATGG
CAGCATCACCCACCTGGTGATCCGACCCAACGGCCGAGTTGCGCTCAGGACCCTCGGGGACACGGGGTTC
ATGCCTCCCGACAAGATCACTCGATCCTGA


Restriction Sites Please inquire
ACCN NM_001170543
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001170543.1, NP_001164014.1
RefSeq Size 2851 bp
RefSeq ORF 870 bp
Locus ID 192111
UniProt ID Q96HS1
Cytogenetics 12q24.33
Protein Families Transmembrane
Summary Displays phosphatase activity for serine/threonine residues, and, dephosphorylates and activates MAP3K5 kinase. Has apparently no phosphoglycerate mutase activity. May be regulator of mitochondrial dynamics. Substrate for a KEAP1-dependent ubiquitin ligase complex. Contributes to the repression of NFE2L2-dependent gene expression. Acts as a central mediator for programmed necrosis induced by TNF, by reactive oxygen species and by calcium ionophore.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:PGAM5 (NM_001170543) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229840 PGAM5 (Myc-DDK-tagged)-Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$450.00
RC229840L1 Lenti ORF clone of Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC229840L2 Lenti ORF clone of Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$750.00
RC229840L3 Lenti ORF clone of Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC229840L4 Lenti ORF clone of Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$750.00
RG229840 PGAM5 (tGFP-tagged) - Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.