RNF135 (NM_001184992) Human Untagged Clone

SKU
SC328471
RNF135 (untagged)-Human ring finger protein 135 (RNF135) transcript variant 3
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RNF135
Synonyms L13; MMFD; REUL; Riplet
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328471 representing NM_001184992.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGGCCTGGGCCTGGGCTCCGCCGTTCCCGTGTGGCTGGCCGAGGACGACCTCGGCTGCATCATC
TGCCAGGGGCTGCTGGACTGGCCCGCCACGCTGCCCTGCGGCCACAGCTTCTGCCGCCACTGCCTGGAG
GCCCTGTGGGGCGCCCGCGACGCCCGCCGCTGGGCCTGCCCCACTTGCCGCCAGGGCGCCGCGCAGCAG
CCGCACCTGCGGAAGAACACGCTACTGCAGGACCTGGCCGACAAGTACCGCCGCGCCGCACGCGAGATA
CAGGCGGGCTCCGACCCTGCCCACTGCCCCTGCCCGGGCTCCAGTTCCCTCTCCAGCGCGGCCGCGAGG
CCCCGGCGCCGCCCGGAACTGCAGCGGGTGGCAGTAGAGAAGAGCATCACAGAAGTTGCTCAGGAGCTG
ACAGAGCTGGTGGAACATCTTGTAGACATTGTCAGAAGCCTGCAGAATCAGAGGCCCCTATCAGAATCT
GGACCAGACAACGAACTGAGCATCCTGGGCAAGGCTTTTTCTTCTGGGGTGGATCTTTCCATGGCTTCT
CCAAAGCTGGTGACTTCCGACACAGCTGCAGGGAAAATCAGAGATATTCTCCATGACCTAGAAGAAATT
CAGGAAAAATTACAAGAAAGCGTCACCTGGAAAGAGGCTCCTGAAGCACAAATGCAGGGTTCTCTGTTG
CCCAGGCTGGAGTGCAGTGGCACAATCACTGCAGCCTCGATCTCTCAGGCTCAGGAGAACTCCTGGAAG
CCCCGTCTTCCTCCTCATGCCCATTGCCTGACCAGAGCCACCCTGCACTCAGGAGAGCTTCTCGGTTTG
CTCAGTGGGCCATCCATCCAACCTTTAACTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001184992
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001184992.1
RefSeq Size 2254 bp
RefSeq ORF 861 bp
Locus ID 84282
UniProt ID Q8IUD6
Cytogenetics 17q11.2
Protein Families Druggable Genome
MW 31 kDa
Summary The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. This gene is located in a chromosomal region known to be frequently deleted in patients with neurofibromatosis. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) has an additional exon in the CDS, which causes a translation frame-shift, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1.
Write Your Own Review
You're reviewing:RNF135 (NM_001184992) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229833 RNF135 (Myc-DDK-tagged)-Human ring finger protein 135 (RNF135), transcript variant 3 10 ug
$300.00
RC229833L3 Lenti ORF clone of Human ring finger protein 135 (RNF135), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC229833L4 Lenti ORF clone of Human ring finger protein 135 (RNF135), transcript variant 3, mGFP tagged 10 ug
$600.00
RG229833 RNF135 (tGFP-tagged) - Human ring finger protein 135 (RNF135), transcript variant 3 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.