CD99L2 (NM_001184808) Human Untagged Clone

SKU
SC328294
CD99L2 (untagged)-Human CD99 molecule-like 2 (CD99L2) transcript variant 4
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CD99L2
Synonyms CD99B; MIC2L1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328294 representing NM_001184808.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGCCTGGCGCTCGGCGTTCCTTGTCTGCCTCGCTTTCTCCTTGGCCACCCTGGTCCAGCGAGGA
TCTGGGGACTTTGATGATTTTAACCTGGAGGATGCAGTGAAAGAAACTTCCTCAGTAAAGCAGCCATGG
GACCACACCACCACCACCACAACCAATAGGCCAGGAACCACCAGAGCTCCGGCAAAACCTCCAGGTAGT
GGATTGGACTTGGCTGATGCTTTGGATGATCAAGATGATGGCCGCAGGAAACCGGGTATAGGAGGAAGA
GGTGATGGCCGGTACGGCAGCAATGACGACCCTGGATCTGGCATGGTGGCAGAGCCTGGCACCATTGCC
GGGGTGGCCAGCGCCCTGGCCATGGCCCTCATCGGTGCCGTCTCCAGCTACATCTCCTACCAGCAGAAG
AAGTTCTGCTTCAGCATTCAGCAGGGTCTCAACGCAGACTACGTGAAGGGAGAGAACCTGGAAGCCGTG
GTATGTGAGGAACCCCAAGTGAAATACTCCACGTTGCACACGCAGTCTGCAGAGCCGCCGCCGCCGCCC
GAACCAGCCCGGATCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001184808
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001184808.1
RefSeq Size 3517 bp
RefSeq ORF 570 bp
Locus ID 83692
UniProt ID Q8TCZ2
Cytogenetics Xq28
Protein Families Transmembrane
MW 20 kDa
Summary This gene encodes a cell-surface protein that is similar to CD99. A similar protein in mouse functions as an adhesion molecule during leukocyte extravasation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (4) lacks three consecutive in-frame exons in one region and an in-frame exon in another region, compared to variant 5. The resulting isoform (4) lacks two internal segments, compared to isoform 5.
Write Your Own Review
You're reviewing:CD99L2 (NM_001184808) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229656 CD99L2 (Myc-DDK-tagged)-Human CD99 molecule-like 2 (CD99L2), transcript variant 4 10 ug
$300.00
RC229656L3 Lenti ORF clone of Human CD99 molecule-like 2 (CD99L2), transcript variant 4, Myc-DDK-tagged 10 ug
$600.00
RC229656L4 Lenti ORF clone of Human CD99 molecule-like 2 (CD99L2), transcript variant 4, mGFP tagged 10 ug
$600.00
RG229656 CD99L2 (tGFP-tagged) - Human CD99 molecule-like 2 (CD99L2), transcript variant 4 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.