IKK gamma (IKBKG) (NM_001099856) Human Untagged Clone

SKU
SC327878
IKBKG (untagged)-Human inhibitor of kappa light polypeptide gene enhancer in B-cells kinase gamma (IKBKG) transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IKK gamma
Synonyms AMCBX1; EDAID1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP; IP1; IP2; IPD2; NEMO; ZC2HC9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327878 representing NM_001099856.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCTTGTGATCCAGGTGGGGAAACTAAGGCCCAGAGAAGTGAGGACCCCGCAGACTATCAATCCC
AGTCTCTTCCCCTCACTCCCTGTGAAGCTCTCCAGCATCATCGAGGTCCCATCAGGTGGGGAAAGATGC
TGTTCCAGGCGCACACTAGTCTACAAGGCCAGAGCTTTCTGGAAGGGGGCACCCTTGCCCTGTTGGATG
AATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAG
GACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCT
CCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAG
ATTCTGCGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTCCTC
ATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAGAGG
CAGAAGGAGCAGGCTCTGCGGGAGGTGGAGCACCTGAAGAGATGCCAGCAGCAGATGGCTGAGGACAAG
GCCTCTGTGAAAGCCCAGGTGACGTCCTTGCTCGGGGAGCTGCAGGAGAGCCAGAGTCGCTTGGAGGCT
GCCACTAAGGAATGCCAGGCTCTGGAGGGTCGGGCCCGGGCGGCCAGCGAGCAGGCGCGGCAGCTGGAG
AGTGAGCGCGAGGCGCTGCAGCAGCAGCACAGCGTGCAGGTGGACCAGCTGCGCATGCAGGGCCAGAGC
GTGGAGGCCGCGCTCCGCATGGAGCGCCAGGCCGCCTCGGAGGAGAAGAGGAAGCTGGCCCAGTTGCAG
GTGGCCTATCACCAGCTCTTCCAAGAATACGACAACCACATCAAGAGCAGCGTGGTGGGCAGTGAGCGG
AAGCGAGGAATGCAGCTGGAAGATCTCAAACAGCAGCTCCAGCAGGCCGAGGAGGCCCTGGTGGCCAAA
CAGGAGGTGATCGATAAGCTGAAGGAGGAGGCCGAGCAGCACAAGATTGTGATGGAGACCGTTCCGGTG
CTGAAGGCCCAGGCGGATATCTACAAGGCGGACTTCCAGGCTGAGAGGCAGGCCCGGGAGAAGCTGGCC
GAGAAGAAGGAGCTCCTGCAGGAGCAGCTGGAGCAGCTGCAGAGGGAGTACAGCAAACTGAAGGCCAGC
TGTCAGGAGTCGGCCAGGATCGAGGACATGAGGAAGCGGCATGTCGAGGTCTCCCAGGCCCCCTTGCCC
CCCGCCCCTGCCTACCTCTCCTCTCCCCTGGCCCTGCCCAGCCAGAGGAGGAGCCCCCCCGAGGAGCCA
CCTGACTTCTGCTGTCCCAAGTGCCAGTATCAGGCCCCTGATATGGACACCCTGCAGATACATGTCATG
GAGTGCATTGAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001099856
Insert Size 1464 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001099856.4
RefSeq Size 2093 bp
RefSeq ORF 1464 bp
Locus ID 8517
UniProt ID Q9Y6K9
Cytogenetics Xq28
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Acute myeloid leukemia, Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Cytosolic DNA-sensing pathway, Epithelial cell signaling in Helicobacter pylori infection, MAPK signaling pathway, NOD-like receptor signaling pathway, Pancreatic cancer, Pathways in cancer, Primary immunodeficiency, Prostate cancer, RIG-I-like receptor signaling pathway, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway
MW 55.8 kDa
Summary This gene encodes the regulatory subunit of the inhibitor of kappaB kinase (IKK) complex, which activates NF-kappaB resulting in activation of genes involved in inflammation, immunity, cell survival, and other pathways. Mutations in this gene result in incontinentia pigmenti, hypohidrotic ectodermal dysplasia, and several other types of immunodeficiencies. A pseudogene highly similar to this locus is located in an adjacent region of the X chromosome. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (2) uses an alternate promoter and initiates translation from an alternate in-frame upstream start codon compared to variant 1. The resulting isoform (b) has a longer N-terminus compared to isoform a.
Write Your Own Review
You're reviewing:IKK gamma (IKBKG) (NM_001099856) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212996 IKBKG (Myc-DDK-tagged)-Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 2 10 ug
$457.00
RC212996L1 Lenti ORF clone of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC212996L2 Lenti ORF clone of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 2, mGFP tagged 10 ug
$757.00
RC212996L3 Lenti ORF clone of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC212996L4 Lenti ORF clone of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 2, mGFP tagged 10 ug
$757.00
RG212996 IKBKG (tGFP-tagged) - Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC316746 IKBKG (untagged)-Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 2 10 ug
$503.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.