HOXA10 (NM_018951) Human Untagged Clone

SKU
SC327835
HOXA10 (untagged)-Human homeobox A10 (HOXA10) transcript variant 1
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HOXA10
Synonyms HOX1; HOX1.8; HOX1H; PL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327835 representing NM_018951.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCAGCCAGAAAGGGCTATCTGCTCCCTTCGCCAAATTATCCCACAACAATGTCATGCTCGGAGAGC
CCCGCCGCGAACTCTTTTTTGGTCGACTCGCTCATCAGCTCGGGCAGAGGCGAGGCAGGCGGCGGTGGT
GGTGGCGCGGGGGGCGGCGGCGGTGGCGGTTACTACGCCCACGGCGGGGTCTACCTGCCGCCCGCCGCC
GACCTGCCCTACGGGCTGCAGAGCTGCGGGCTCTTCCCCACGCTGGGCGGCAAGCGCAATGAGGCAGCG
TCGCCGGGCAGCGGTGGCGGTGGCGGGGGTCTAGGTCCCGGGGCGCACGGCTACGGGCCCTCGCCCATA
GACCTGTGGCTAGACGCGCCCCGGTCTTGCCGGATGGAGCCGCCTGACGGGCCGCCGCCGCCGCCCCAG
CAGCAGCCGCCGCCCCCGCCGCAACCACCCCAGCCAGCGCCGCAGGCCACCTCGTGCTCTTTCGCGCAG
AACATCAAAGAAGAGAGCTCCTACTGCCTCTACGACTCGGCGGACAAATGCCCCAAAGTCTCGGCCACC
GCCGCCGAACTGGCTCCCTTCCCGCGGGGCCCGCCGCCCGACGGCTGCGCCCTGGGCACCTCCAGCGGG
GTGCCAGTGCCTGGCTACTTCCGCCTTTCTCAGGCCTACGGCACCGCCAAGGGCTATGGCAGCGGCGGC
GGCGGCGCGCAGCAACTCGGGGCTGGCCCGTTCCCCGCGCAGCCCCCGGGGCGCGGTTTCGATCTCCCG
CCCGCGCTAGCCTCCGGCTCGGCCGATGCGGCCCGGAAGGAGCGAGCCCTCGATTCGCCGCCGCCCCCC
ACGCTGGCTTGCGGCAGCGGCGGGGGCTCGCAGGGCGACGAGGAGGCGCACGCGTCGTCCTCGGCCGCG
GAGGAGCTCTCCCCGGCCCCTTCCGAGAGCAGCAAAGCCTCGCCGGAGAAGGATTCCCTGGGCAATTCC
AAAGGTGAAAACGCAGCCAACTGGCTCACGGCAAAGAGTGGTCGGAAGAAGCGCTGCCCCTACACGAAG
CACCAGACACTGGAGCTGGAGAAGGAGTTTCTGTTCAATATGTACCTTACTCGAGAGCGGCGCCTAGAG
ATTAGCCGCAGCGTCCACCTCACGGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAACTG
AAGAAAATGAATCGAGAAAACCGGATCCGGGAGCTCACAGCCAACTTTAATTTTTCCTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII
ACCN NM_018951
Insert Size 1233 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018951.3
RefSeq Size 2648 bp
RefSeq ORF 1233 bp
Locus ID 3206
UniProt ID P31260
Cytogenetics 7p15.2
Protein Families Transcription Factors
MW 42.4 kDa
Summary In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor that may regulate gene expression, morphogenesis, and differentiation. More specifically, it may function in fertility, embryo viability, and regulation of hematopoietic lineage commitment. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the downstream homeobox A9 (HOXA9) gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. Sequence Note: An upstream start codon is selected for this RefSeq based on conservation in at least 24 vertebrate species including mouse, rat, human, chimp, macaque, dog, cow, chicken, lizard, Xenopus tropicalis, Tetraodon and Fugu. Historically, a start codon that is 17 aa downstream has been used as the translation AUG start codon. No experimental evidence exists regarding which site is preferentially used.
Write Your Own Review
You're reviewing:HOXA10 (NM_018951) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202939 HOXA10 (Myc-DDK-tagged)-Human homeobox A10 (HOXA10), transcript variant 1 10 ug
$457.00
RC202939L3 Lenti ORF clone of Human homeobox A10 (HOXA10), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC202939L4 Lenti ORF clone of Human homeobox A10 (HOXA10), transcript variant 1, mGFP tagged 10 ug
$757.00
RC229200 HOXA10 (Myc-DDK-tagged)-Human homeobox A10 (HOXA10), transcript variant 1 10 ug
$457.00
RG202939 HOXA10 (tGFP-tagged) - Human homeobox A10 (HOXA10), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00
RG229200 HOXA10 (tGFP-tagged) - Human homeobox A10 (HOXA10), transcript variant 1 10 ug
$657.00
SC122879 HOXA10 (untagged)-Human homeobox A10 (HOXA10), transcript variant 1 10 ug
$457.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.