RIBC2 (NM_015653) Human Untagged Clone

SKU
SC327813
RIBC2 (untagged)-Human RIB43A domain with coiled-coils 2 (RIBC2)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RIBC2
Synonyms C22orf11; TRIB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_015653, the custom clone sequence may differ by one or more nucleotides


ATGGGTTCCCAGACCATGGCGGTGGCGCTGCCCAGGGACTTGCGGCAGGACGCCAACCTGGCAAAGAGGA
GGCACGCGGAGCTGTGCAGGCAGAAGCGGGTCTTCAACGCCAGAAACAGGATAATTGGGGGAGACACTGA
AGCCTGGGATGTTCAAGTTCATGACCAGAAGATAAAAGAAGCTACTGAAAAAGCTAGACATGAAACCTTT
GCTGCTGAAATGAGGCAAAATGACAAAATCATGTGCATATTGGAAAACCGGAAAAAGAGGGATAGGAAAA
ATCTCTGTAGGGCTATCAATGACTTCCAACAGAGCTTTCAGAAGCCAGAAACTCGCCGTGAATTTGATCT
GTCCGACCCCCTAGCCCTTAAGAAAGATCTTCCAGCCCGGCAGTCAGATAATGATGTTCGGAATACGATA
TCAGGAATGCAGAAATTCATGGGAGAGGATTTAAACTTCCATGAGAGGAAGAAATTCCAAGAGGAACAAA
ACAGAGAATGGTCTTTGCAGCAGCAAAGGGAATG


Restriction Sites SgfI-MluI
ACCN NM_015653
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015653.4, NP_056468.3
RefSeq Size 720 bp
RefSeq ORF 524 bp
Locus ID 26150
UniProt ID Q9H4K1
Cytogenetics 22q13.31
Write Your Own Review
You're reviewing:RIBC2 (NM_015653) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200766 RIBC2 (Myc-DDK-tagged)-Human RIB43A domain with coiled-coils 2 (RIBC2) 10 ug
$300.00
RC200766L3 Lenti ORF clone of Human RIB43A domain with coiled-coils 2 (RIBC2), Myc-DDK-tagged 10 ug
$600.00
RC200766L4 Lenti ORF clone of Human RIB43A domain with coiled-coils 2 (RIBC2), mGFP tagged 10 ug
$600.00
RG200766 RIBC2 (tGFP-tagged) - Human RIB43A domain with coiled-coils 2 (RIBC2) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC122827 RIBC2 (untagged)-Human RIB43A domain with coiled-coils 2 (RIBC2) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.