CGREF1 (NM_006569) Human Untagged Clone

SKU
SC327791
CGREF1 (untagged)-Human cell growth regulator with EF-hand domain 1 (CGREF1) transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CGREF1
Synonyms CGR11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327791 representing NM_006569.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTACCTTTGACGATGACAGTGTTAATCCTGCTGCTGCTCCCCACGGGTCAGGCTGCCCCAAAGGAT
GGAGTCACAAGGCCAGACTCTGAAGTGCAGCATCAGCTCCTGCCCAACCCCTTCCAGCCAGGCCAGGAG
CAGCTCGGACTTCTGCAGAGCTACCTAAAGGGACTAGGAAGGACAGAAGTGCAACTGGAGCATCTGAGC
CGGGAGCAGGTTCTCCTCTACCTCTTTGCCCTCCATGACTATGACCAGAGTGGACAGCTGGATGGCCTG
GAGCTGCTGTCCATGTTGACAGCTGCTCTGGCCCCTGGAGCTGCCAACTCTCCTACCACCAACCCGGTG
ATCTTGATAGTGGACAAAGTGCTCGAGACCCAGGACCTGAATGGGGATGGGCTCATGACCCCTGCTGAG
CTCATCAACTTCCCGGGAGTAGCCCTCAGGCACGTGGAGCCCGGAGAGCCCCTTGCTCCATCTCCTCAG
GAGCCACAAGCTGTTGGAAGGCAGTCCCTATTAGCTAAAAGCCCATTAAGACAAGAAACACAGGAAGCC
CCTGGTCCCAGAGAAGAAGCAAAGGGCCAGGTAGAGGCCAGAAGGGAGTCTTTGGATCCTGTCCAGGAG
CCTGGGGGCCAGGCAGAGGCTGATGGAGATGTTCCAGGGCCCAGAGGGGAAGCTGAGGGCCAGGCAGAG
GCTAAAGGAGATGCCCCTGGGCCCAGAGGGGAAGCTGGGGGCCAGGCAGAGGCTGAAGGAGATGCCCCC
GGGCCCAGAGGGGAAGCTGGGGGCCAGGCAGAGGCTGAAGGAGATGCCCCCGGGCCCAGAGGGGAAGCT
GGGGGCCAGGCAGAGGCCAGGGAGAATGGAGAGGAGGCCAAGGAACTTCCAGGGGAAACACTGGAGTCT
AAGAACACCCAAAATGACTTTGAGGTGCACATTGTTCAAGTGGAGAATGATGAGATCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_006569
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006569.5
RefSeq Size 1934 bp
RefSeq ORF 957 bp
Locus ID 10669
UniProt ID Q99674
Cytogenetics 2p23.3
Domains EFh
MW 33.5 kDa
Summary Mediates cell-cell adhesion in a calcium-dependent manner (By similarity). Able to inhibit growth in several cell lines.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:CGREF1 (NM_006569) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206520 CGREF1 (Myc-DDK-tagged)-Human cell growth regulator with EF-hand domain 1 (CGREF1), transcript variant 1 10 ug
$300.00
RC206520L3 Lenti ORF clone of Human cell growth regulator with EF-hand domain 1 (CGREF1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC206520L4 Lenti ORF clone of Human cell growth regulator with EF-hand domain 1 (CGREF1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG206520 CGREF1 (tGFP-tagged) - Human cell growth regulator with EF-hand domain 1 (CGREF1), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC115999 CGREF1 (untagged)-Human cell growth regulator with EF-hand domain 1 (CGREF1), transcript variant 1 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.