FYTTD1 (NM_001011537) Human Untagged Clone

SKU
SC327779
FYTTD1 (untagged)-Human forty-two-three domain containing 1 (FYTTD1) transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FYTTD1
Synonyms UIF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327779 representing NM_001011537.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCTTCTGTGATTATGGGAAATGATATCATCAAGTTGAATCGAAAGGAAGGGAAGAAGCAGAAT
TTTCCAAGACTAAATAGAAGACTCCTCCAGCAAAGTGGTGCCCAGCAATTCAGGATGAGAGTGCGATGG
GGAATCCAACAGAATTCTGGTTTTGGTAAGACTAGTCTGAATCGTAGAGGAAGAGTAATGCCTGGAAAG
AGACGTCCTAATGGAGTTATCACTGGCCTTGCAGCTAGGAAAACGACTGGAATTCGAAAAGGAATTAGT
CCTATGAATCGTCCACCTCTAAGTGACAAGAATATAGAACAATATTTTCCAGTGTTAAAAAGGAAGGCA
AACCTTCTGAGACAAAATGAAGGGCAGAGGAAACCAGTAGCAGTTCTCAAGAGACCTAGCCAGCTAAGC
AGAAAAAATAACATTCCAGCTAATTTTACCAGGAGTGGAAATAAATTAAATCATCAGAAAGATACTCGT
CAGGCAACTTTTCTTTTCAGAAGAGGCCTGAAGGTGCAGGCCCAGTTGAATACAGAACAACTGCTAGAC
GATGTAGTAGCAAAGAGAACTCGTCAATGGCGGACTTCCACCACAAATGGAGGGATTTTGACTGTATCT
ATTGACAATCCTGGAGCAGTGCAATGCCCAGTAACTCAGAAACCACGATTAACTCGTACTGCTGTACCT
TCATTTTTAACAAAGCGGGAGCAAAGTGACGTCAAGAAAGTTCCTAAAGGTGTTCCCCTGCAGTTTGAC
ATAAACAGTGTCGGAAAACAGACAGGGATGACGTTGAATGAGCGGTTTGGGATCCTGAAGGAACAAAGA
GCCACTCTCACATACAACAAAGGGGGAAGCCGCTTTGTCACCGTGGGATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001011537
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001011537.2
RefSeq Size 3654 bp
RefSeq ORF 879 bp
Locus ID 84248
UniProt ID Q96QD9
Cytogenetics 3q29
MW 33 kDa
Summary Required for mRNA export from the nucleus to the cytoplasm. Acts as an adapter that uses the DDX39B/UAP56-NFX1 pathway to ensure efficient mRNA export and delivering to the nuclear pore. Associates with spliced and unspliced mRNAs simultaneously with ALYREF/THOC4.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.
Write Your Own Review
You're reviewing:FYTTD1 (NM_001011537) Human Untagged Clone
Your Rating
SKU Description Size Price
RC229144 FYTTD1 (Myc-DDK-tagged)-Human forty-two-three domain containing 1 (FYTTD1), transcript variant 2 10 ug
$300.00
RC229144L3 Lenti ORF clone of Human forty-two-three domain containing 1 (FYTTD1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC229144L4 Lenti ORF clone of Human forty-two-three domain containing 1 (FYTTD1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG229144 FYTTD1 (tGFP-tagged) - Human forty-two-three domain containing 1 (FYTTD1), transcript variant 2 10 ug
$500.00
SC301568 FYTTD1 (untagged)-Human forty-two-three domain containing 1 (FYTTD1), transcript variant 2 10 ug
$330.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.