HDHD1A (PUDP) (NM_012080) Human Untagged Clone

SKU
SC327761
HDHD1 (untagged)-Human haloacid dehalogenase-like hydrolase domain containing 1A (HDHD1A) transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HDHD1A
Synonyms DXF68S1E; FAM16AX; GS1; HDHD1; HDHD1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327761 representing NM_012080.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCGCCCCCGCAGCCCGTCACCCACCTCATCTTTGACATGGACGGACTTCTTCTGGATACTGAA
CGGCTGTATTCAGTGGTGTTTCAAGAAATATGTAATCGCTATGACAAGAAATACAGCTGGGATGTAAAG
TCCCTGGTTATGGGTAAGAAGGCATTAGAGGCGGCACAGATTATAATAGACGTCTTGCAGCTCCCGATG
TCCAAAGAGGAGCTGGTGGAAGAAAGCCAAACGAAGTTAAAGGAAGTGTTCCCCACGGCTGCGCTCATG
CCAGGGGCGGAGAAACTCATCATCCACCTGCGGAAACATGGCATCCCCTTTGCACTGGCCACCAGCTCG
GGGTCCGCGTCGTTCGATATGAAGACAAGCCGCCACAAGGAGTTCTTCAGCTTGTTTTCCCACATTGTG
CTGGGAGATGACCCCGAAGTGCAGCATGGCAAGCCAGACCCGGACATCTTCCTAGCTTGTGCCAAGAGG
TTCTCTCCCCCTCCTGCTATGGAGAAGTGCCTTGTCTTTGAAGATGCTCCCAATGGGGTGGAGGCGGCC
CTGGCAGCTGGGATGCAGGTGGTCATGGTTCCTGACGGAAACTTGAGCCGAGATCTGACAACAAAGGCC
ACCCTGGTGCTGAATTCCCTGCAGGACTTCCAGCCCGAGCTGTTTGGTTTGCCCTCCTATGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_012080
Insert Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012080.4
RefSeq Size 2155 bp
RefSeq ORF 687 bp
Locus ID 8226
UniProt ID Q08623
Cytogenetics Xp22.31
MW 25.2 kDa
Summary This gene encodes a member of the haloacid dehalogenase-like (HAD) hydrolase superfamily. The encoded protein has no known biological function. This gene has a pseudogene on chromosome 1. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
Write Your Own Review
You're reviewing:HDHD1A (PUDP) (NM_012080) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204419 HDHD1 (Myc-DDK-tagged)-Human haloacid dehalogenase-like hydrolase domain containing 1 (HDHD1), transcript variant 2 10 ug
$300.00
RC204419L3 Lenti ORF clone of Human haloacid dehalogenase-like hydrolase domain containing 1 (HDHD1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC204419L4 Lenti ORF clone of Human haloacid dehalogenase-like hydrolase domain containing 1 (HDHD1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG204419 HDHD1 (tGFP-tagged) - Human haloacid dehalogenase-like hydrolase domain containing 1 (HDHD1), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC122778 HDHD1 (untagged)-Human haloacid dehalogenase-like hydrolase domain containing 1 (HDHD1), transcript variant 2 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.