PAK2 (NM_002577) Human Untagged Clone

SKU
SC327574
PAK2 (untagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2)
$733.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PAK2
Synonyms PAK65; PAKgamma
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_002577 edited
AGATCTGGTACCGATGTCTGATAACGGAGAACTGGAAGATAAGCCTCCAGCACCTCCTGT
GCGAATGAGCAGCACCATCTTTAGCACTGGAGGCAAAGACCCTTTGTCAGCCAATCACAG
TTTGAAACCTTTGCCCTCTGTTCCAGAAGAGAAAAAGCCCAGGCATAAAATCATCTCCAT
ATTCTCAGGCACAGAGAAAGGAAGTAAAAAGAAAGAAAAGGAACGGCCAGAAATTTCTCC
TCCATCTGATTTTGAGCACACCATCCATGTTGGCTTTGATGCTGTTACTGGAGAATTCAC
TGGCATGCCAGAACAGTGGGCTCGATTACTACAGACCTCCAATATCACCAAACTAGAGCA
AAAGAAGAATCCTCAGGCTGTGCTGGATGTCCTAAAGTTCTACGACTCCAACACAGTGAA
GCAGAAATATCTGAGCTTTACTCCTCCTGAGAAAGATGGCTTTCCTTCTGGAACACCAGC
ACTGAATGCCAAGGGAACAGAAGCACCCGCAGTAGTGACAGAGGAGGAGGATGATGATGA
AGAGACTGCTCCTCCCGTTATTGCCCCGCGACCGGATCATACGAAATCAATTTACACACG
GTCTGTAATTGACCCTGTTCCTGCACCAGTTGGTGATTCACATGTTGATGGTGCTGCCAA
GTCTTTAGACAAACAGAAAAAGAAGACTAAGATGACAGATGAAGAGATTATGGAGAAATT
AAGAACTATCGTGAGCATAGGTGACCCTAAGAAAAAATATACAAGATATGAAAAAATTGG
ACAAGGGGCTTCTGGTACAGTTTTCACTGCTACTGACGTTGCACTGGGACAGGAGGTTGC
TATCAAACAAATTAATTTACAGAAACAGCCAAAGAAGGAACTGATCATTAACGAGATTCT
GGTGATGAAAGAATTGAAAAATCCCAACATCGTTAACTTTTTGGACAGTTACCTGGTAGG
AGATGAATTGTTTGTGGTCATGGAATACCTTGCTGGGGGGTCACTCACTGATGTGGTAAC
AGAAACGTGCATGGATGAAGCACAGATTGCTGCTGTATGCAGAGAGTGTTTACAGGCATT
GGAGTTTTTACATGCTAATCAAGTGATCCACAGAGACATCAAAAGTGACAATGTACTTTT
GGGAATGGAAGGATCTGTTAAGCTCACTGACTTTGGTTTCTGTGCCCAGATCACCCCTGA
GCAGAGCAAACGCAGTACCATGGTCGGAACGCCATACTGGATGGCACCAGAGGTGGTTAC
ACGGAAAGCTTATGGCCCTAAAGTCGACATATGGTCTCTGGGTATCATGGCTATTGAGAT
GGTAGAAGGAGAGCCTCCATACCTCAATGAAAATCCCTTGAGGGCCTTGTACCTAATAGC
AACTAATGGAACCCCAGAACTTCAGAATCCAGAGAAACTTTCCCCAATATTTCGGGATTT
CTTAAATCGATGTTTGGAAATGGATGTGGAAAAAAGGGGTTCAGCCAAAGAATTATTACA
GCATCCTTTCCTGAAACTGGCCAAACCGTTATCTAGCTTGACACCACTGATCATGGCAGC
TAAAGAAGCAATGAAGAGTAACCGTTAACATCACTGCTGTGGCCTCATACTCTTTTT
Restriction Sites Please inquire
ACCN NM_002577
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002577.4, NP_002568.2
RefSeq Size 6139 bp
RefSeq ORF 1575 bp
Locus ID 5062
UniProt ID Q13177
Cytogenetics 3q29
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Axon guidance, ErbB signaling pathway, Focal adhesion, MAPK signaling pathway, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway
Summary The p21 activated kinases (PAK) are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. The PAK proteins are a family of serine/threonine kinases that serve as targets for the small GTP binding proteins, CDC42 and RAC1, and have been implicated in a wide range of biological activities. The protein encoded by this gene is activated by proteolytic cleavage during caspase-mediated apoptosis, and may play a role in regulating the apoptotic events in the dying cell. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:PAK2 (NM_002577) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210165 PAK2 (Myc-DDK-tagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2). Note: ORF is codon optimized 10 ug
$731.00
RC210165L3 Lenti-ORF clone of PAK2 (Myc-DDK-tagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2). Note: ORF is codon optimized 10 ug
$1,031.00
RC210165L4 Lenti-ORF clone of PAK2 (mGFP-tagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2). Note: ORF is codon optimized 10 ug
$1,031.00
RG210165 PAK2 (tGFP-tagged) - Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2). Note: ORF is codon optimized 10 ug
$931.00
SC315439 PAK2 (untagged)-Human p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2) 10 ug
$733.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.