HIC5 (TGFB1I1) (NM_001164719) Human Untagged Clone

SKU
SC327534
TGFB1I1 (untagged)-Human transforming growth factor beta 1 induced transcript 1 (TGFB1I1) transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HIC5
Synonyms ARA55; HIC-5; HIC5; TSC-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327534 representing NM_001164719.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCAAGGTCAGGGGCTCCCAAAGAGCGCCCTGCGGAGCCTCTCACCCCTCCCCCATCCTATGGCCAC
CAGCCACAGACAGGGTCTGGGGAGTCTTCAGGAGCCTCGGGGGACAAGGACCACCTGTACAGCACGGTA
TGCAAGCCTCGGTCCCCAAAGCCTGCAGCCCCGGCGGCCCCTCCATTCTCCTCTTCCAGCGGTGTCTTG
GGTACCGGGCTCTGTGAGCTAGATCGGTTGCTTCAGGAACTTAATGCCACTCAGTTCAACATCACAGAT
GAAATCATGTCTCAGTTCCCATCTAGCAAGGTGGCTTCAGGAGAGCAGAAGGAGGACCAGTCTGAAGAT
AAGAAAAGACCCAGCCTCCCTTCCAGCCCGTCTCCTGGCCTCCCAAAGGCTTCTGCCACCTCAGCCACT
CTGGAGCTGGATAGACTGATGGCCTCACTCTCTGACTTCCGCGTTCAAAACCATCTTCCAGCCTCTGGG
CCAACTCAGCCACCGGTGGTGAGCTCCACAAATGAGGGCTCCCCATCCCCACCAGAGCCGACTGGCAAG
GGCAGCCTAGACACCATGCTGGGGCTGCTGCAGTCCGACCTCAGCCGCCGGGGTGTTCCCACCCAGGCC
AAAGGCCTCTGTGGCTCCTGCAATAAACCTATTGCTGGGCAAGTGGTGACGGCTCTGGGCCGCGCCTGG
CACCCCGAGCACTTCGTTTGCGGAGGCTGTTCCACCGCCCTGGGAGGCAGCAGCTTCTTCGAGAAGGAT
GGAGCCCCCTTCTGCCCCGAGTGCTACTTTGAGCGCTTCTCGCCAAGATGTGGCTTCTGCAACCAGCCC
ATCCGACACAAGATGGTGACCGCCTTGGGCACTCACTGGCACCCAGAGCATTTCTGCTGCGTCAGTTGC
GGGGAGCCCTTCGGAGATGAGGGTTTCCACGAGCGCGAGGGCCGCCCCTACTGCCGCCGGGACTTCCTG
CAGCTGTTCGCCCCGCGCTGCCAGGGCTGCCAGGGCCCCATCCTGGATAACTACATCTCGGCGCTCAGC
GCGCTCTGGCACCCGGACTGTTTCGTCTGCAGGGAATGCTTCGCGCCCTTCTCGGGAGGCAGCTTTTTC
GAGCACGAGGGCCGCCCGTTGTGCGAGAACCACTTCCACGCACGACGCGGCTCGCTGTGCGCCACGTGT
GGCCTCCCTGTGACCGGCCGCTGCGTGTCGGCCCTGGGTCGCCGCTTCCACCCGGACCACTTCACATGC
ACCTTCTGCCTGCGCCCGCTCACCAAGGGGTCCTTCCAGGAGCGCGCCGGCAAGCCCTACTGCCAGCCC
TGCTTCCTGAAGCTCTTCGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001164719
Insert Size 1335 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001164719.1
RefSeq Size 1782 bp
RefSeq ORF 1335 bp
Locus ID 7041
UniProt ID O43294
Cytogenetics 16p11.2
Protein Families Druggable Genome, Transcription Factors
MW 47.9 kDa
Summary This gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role to play in the treatment of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (3) differs in the 5' UTR and coding region, and initiates translation at an alternate start codon compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Variants 2 and 3 encode the same protein.
Write Your Own Review
You're reviewing:HIC5 (TGFB1I1) (NM_001164719) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228899 TGFB1I1 (Myc-DDK-tagged)-Human transforming growth factor beta 1 induced transcript 1 (TGFB1I1), transcript variant 3 10 ug
$457.00
RC228899L1 Lenti ORF clone of Human transforming growth factor beta 1 induced transcript 1 (TGFB1I1), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC228899L2 Lenti ORF clone of Human transforming growth factor beta 1 induced transcript 1 (TGFB1I1), transcript variant 3, mGFP tagged 10 ug
$757.00
RC228899L3 Lenti ORF clone of Human transforming growth factor beta 1 induced transcript 1 (TGFB1I1), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC228899L4 Lenti ORF clone of Human transforming growth factor beta 1 induced transcript 1 (TGFB1I1), transcript variant 3, mGFP tagged 10 ug
$757.00
RG228899 TGFB1I1 (tGFP-tagged) - Human transforming growth factor beta 1 induced transcript 1 (TGFB1I1), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.