GSK3 beta (GSK3B) (NM_001146156) Human Untagged Clone

SKU
SC327523
GSK3B (untagged)-Human glycogen synthase kinase 3 beta (GSK3B) transcript variant 2
$732.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GSK3 beta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327523 representing NM_001146156.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCAGGGCGGCCCAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCGGTGCAGCAGCCTTCAGCTTTT
GGCAGCATGAAAGTTAGCAGAGACAAGGACGGCAGCAAGGTGACAACAGTGGTGGCAACTCCTGGGCAG
GGTCCAGACAGGCCACAAGAAGTCAGCTATACAGACACTAAAGTGATTGGAAATGGATCATTTGGTGTG
GTATATCAAGCCAAACTTTGTGATTCAGGAGAACTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGA
TTTAAGAATCGAGAGCTCCAGATCATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTC
TTCTACTCCAGTGGTGAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACA
GTATACAGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTGTAT
ATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGGGATATTAAACCG
CAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAGCAGCTG
GTCCGAGGAGAACCCAATGTTTCGTATATCTGTTCTCGGTACTATAGGGCACCAGAGTTGATCTTTGGA
GCCACTGATTATACCTCTAGTATAGATGTATGGTCTGCTGGCTGTGTGTTGGCTGAGCTGTTACTAGGA
CAACCAATATTTCCAGGGGATAGTGGTGTGGATCAGTTGGTAGAAATAATCAAGGTCCTGGGAACTCCA
ACAAGGGAGCAAATCAGAGAAATGAACCCAAACTACACAGAATTTAAATTCCCTCAAATTAAGGCACAT
CCTTGGACTAAGGTCTTCCGACCCCGAACTCCACCGGAGGCAATTGCACTGTGTAGCCGTCTGCTGGAG
TATACACCAACTGCCCGACTAACACCACTGGAAGCTTGTGCACATTCATTTTTTGATGAATTACGGGAC
CCAAATGTCAAACTACCAAATGGGCGAGACACACCTGCACTCTTCAACTTCACCACTCAAGAACTGTCA
AGTAATCCACCTCTGGCTACCATCCTTATTCCTCCTCATGCTCGGATTCAAGCAGCTGCTTCAACCCCC
ACAAATGCCACAGCAGCGTCAGATGCTAATACTGGAGACCGTGGACAGACCAATAATGCTGCTTCTGCA
TCAGCTTCCAACTCCACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001146156
Insert Size 1263 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001146156.1
RefSeq Size 7095 bp
RefSeq ORF 1263 bp
Locus ID 2932
UniProt ID P49841
Cytogenetics 3q13.33
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Alzheimer's disease, Axon guidance, B cell receptor signaling pathway, Basal cell carcinoma, Cell cycle, Chemokine signaling pathway, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Focal adhesion, Hedgehog signaling pathway, Insulin signaling pathway, Melanogenesis, Neurotrophin signaling pathway, Pathways in cancer, Prostate cancer, T cell receptor signaling pathway, Wnt signaling pathway
MW 46.7 kDa
Summary The protein encoded by this gene is a serine-threonine kinase belonging to the glycogen synthase kinase subfamily. It is a negative regulator of glucose homeostasis and is involved in energy metabolism, inflammation, ER-stress, mitochondrial dysfunction, and apoptotic pathways. Defects in this gene have been associated with Parkinson disease and Alzheimer disease. [provided by RefSeq, Aug 2017]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:GSK3 beta (GSK3B) (NM_001146156) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228888 GSK3B (Myc-DDK-tagged)-Human glycogen synthase kinase 3 beta (GSK3B), transcript variant 2 10 ug
$686.00
RC228888L1 Lenti-ORF clone of GSK3B (Myc-DDK-tagged)-Human glycogen synthase kinase 3 beta (GSK3B), transcript variant 2 10 ug
$986.00
RC228888L2 Lenti-ORF clone of GSK3B (mGFP-tagged)-Human glycogen synthase kinase 3 beta (GSK3B), transcript variant 2 10 ug
$986.00
RC228888L3 Lenti-ORF clone of GSK3B (Myc-DDK-tagged)-Human glycogen synthase kinase 3 beta (GSK3B), transcript variant 2 10 ug
$986.00
RC228888L4 Lenti-ORF clone of GSK3B (mGFP-tagged)-Human glycogen synthase kinase 3 beta (GSK3B), transcript variant 2 10 ug
$986.00
RG228888 GSK3B (tGFP-tagged) - Human glycogen synthase kinase 3 beta (GSK3B), transcript variant 2 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.