HSD3B2 (NM_001166120) Human Untagged Clone

SKU
SC327490
HSD3B2 (untagged)-Human hydroxy-delta-5-steroid dehydrogenase 3 beta- and steroid delta-isomerase 2 (HSD3B2) transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HSD3B2
Synonyms HSD3B; HSDB; SDR11E2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327490 representing NM_001166120.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCTGGAGCTGCCTTGTGACAGGAGCAGGAGGGCTTCTGGGTCAGAGGATCGTCCGCCTGTTGGTG
GAAGAGAAGGAACTGAAGGAGATCAGGGCCTTGGACAAGGCCTTCAGACCAGAATTGAGAGAGGAATTT
TCTAAGCTCCAGAACAGGACCAAGCTGACTGTACTTGAAGGAGACATTCTGGATGAGCCATTCCTGAAA
AGAGCCTGCCAGGACGTCTCGGTCGTCATCCACACCGCCTGTATCATTGATGTCTTTGGTGTCACTCAC
AGAGAGTCCATCATGAATGTCAATGTGAAAGGTACCCAGCTACTGTTGGAGGCCTGTGTCCAAGCCAGT
GTGCCAGTCTTCATCTACACCAGTAGCATAGAGGTAGCCGGGCCCAACTCCTACAAGGAAATCATCCAG
AACGGCCACGAAGAAGAGCCTCTGGAAAACACATGGCCCACTCCATACCCGTACAGCAAAAAGCTTGCT
GAGAAGGCTGTGCTGGCGGCTAATGGGTGGAATCTAAAAAATGGTGATACCTTGTACACTTGTGCGTTA
AGACCCACATATATCTATGGGGAAGGAGGCCCATTCCTTTCTGCCAGTATAAATGAGGCCCTGAACAAC
AATGGGATCCTGTCAAGTGTTGGAAAGTTCTCTACAGTCAACCCAGTCTATGTTGGCAACGTGGCCTGG
GCCCACATTCTGGCCTTGAGGGCTCTGCGGGACCCCAAGAAGGCCCCAAGTGTCCGAGGTCAATTCTAT
TACATCTCAGATGACACGCCTCACCAAAGCTATGATAACCTTAATTACATCCTGAGCAAAGAGTTTGGC
CTCCGCCTTGATTCCAGATGGAGCCTTCCTTTAACCCTGATGTACTGGATTGGCTTCCTGCTGGAAGTA
GTGAGCTTCCTACTCAGCCCAATTTACTCCTATCAACCCCCCTTCAACCGCCACACAGTCACATTATCA
AATAGTGTGTTCACCTTCTCTTACAAGAAGGCTCAGCGAGATCTGGCGTATAAGCCACTCTACAGCTGG
GAGGAAGCCAAGCAGAAAACCGTGGAGTGGGTTGGTTCCCTTGTGGACCGGCACAAGGAGACCCTGAAG
TCCAAGACTCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001166120
Insert Size 1119 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001166120.1
RefSeq Size 1807 bp
RefSeq ORF 1119 bp
Locus ID 3284
UniProt ID P26439
Cytogenetics 1p12
Protein Families Druggable Genome, Transmembrane
Protein Pathways Androgen and estrogen metabolism, C21-Steroid hormone metabolism, Metabolic pathways
MW 42.1 kDa
Summary The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) contains an alternate 5' non-coding exon, hence differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:HSD3B2 (NM_001166120) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228855 HSD3B2 (Myc-DDK-tagged)-Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 (HSD3B2), transcript variant 2 10 ug
$457.00
RC228855L3 Lenti ORF clone of Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 (HSD3B2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC228855L4 Lenti ORF clone of Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 (HSD3B2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG228855 HSD3B2 (tGFP-tagged) - Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 (HSD3B2), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.