PAF Receptor (PTAFR) (NM_001164723) Human Untagged Clone

SKU
SC327467
PTAFR (untagged)-Human platelet-activating factor receptor (PTAFR) transcript variant 4
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PAF Receptor
Synonyms PAFR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327467 representing NM_001164723.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCACATGACTCCTCCCACATGGACTCTGAGTTCCGATACACTCTCTTCCCGATTGTTTACAGC
ATCATCTTTGTGCTCGGGGTCATTGCTAATGGCTACGTGCTGTGGGTCTTTGCCCGCCTGTACCCTTGC
AAGAAATTCAATGAGATAAAGATCTTCATGGTGAACCTCACCATGGCGGACATGCTCTTCTTGATCACC
CTGCCACTTTGGATTGTCTACTACCAAAACCAGGGCAACTGGATACTCCCCAAATTCCTGTGCAACGTG
GCTGGCTGCCTTTTCTTCATCAACACCTACTGCTCTGTGGCCTTCCTGGGCGTCATCACTTATAACCGC
TTCCAGGCAGTAACTCGGCCCATCAAGACTGCTCAGGCCAACACCCGCAAGCGTGGCATCTCTTTGTCC
TTGGTCATCTGGGTGGCCATTGTGGGAGCTGCATCCTACTTCCTCATCCTGGACTCCACCAACACAGTG
CCCGACAGTGCTGGCTCAGGCAACGTCACTCGCTGCTTTGAGCATTACGAGAAGGGCAGCGTGCCAGTC
CTCATCATCCACATCTTCATCGTGTTCAGCTTCTTCCTGGTCTTCCTCATCATCCTCTTCTGCAACCTG
GTCATCATCCGTACCTTGCTCATGCAGCCGGTGCAGCAGCAGCGCAACGCTGAAGTCAAGCGCCGGGCG
CTGTGGATGGTGTGCACGGTCTTGGCGGTGTTCATCATCTGCTTCGTGCCCCACCACGTGGTGCAGCTG
CCCTGGACCCTTGCTGAGCTGGGCTTCCAGGACAGCAAATTCCACCAGGCCATTAATGATGCACATCAG
GTCACCCTCTGCCTCCTTAGCACCAACTGTGTCTTAGACCCTGTTATCTACTGTTTCCTCACCAAGAAG
TTCCGCAAGCACCTCACCGAAAAGTTCTACAGCATGCGCAGTAGCCGGAAATGCTCCCGGGCCACCACG
GATACGGTCACTGAAGTGGTTGTGCCATTCAACCAGATCCCTGGCAATTCCCTCAAAAATTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001164723
Insert Size 1029 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001164723.2
RefSeq Size 4318 bp
RefSeq ORF 1029 bp
Locus ID 5724
UniProt ID P25105
Cytogenetics 1p35.3
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
MW 39.2 kDa
Summary This gene encodes a seven-transmembrane G-protein-coupled receptor for platelet-activating factor (PAF) that localizes to lipid rafts and/or caveolae in the cell membrane. PAF (1-0-alkyl-2-acetyl-sn-glycero-3-phosphorylcholine) is a phospholipid that plays a significant role in oncogenic transformation, tumor growth, angiogenesis, metastasis, and pro-inflammatory processes. Binding of PAF to the PAF-receptor (PAFR) stimulates numerous signal transduction pathways including phospholipase C, D, A2, mitogen-activated protein kinases (MAPKs), and the phosphatidylinositol-calcium second messenger system. Following PAFR activation, cells become rapidly desensitized and this refractory state is dependent on PAFR phosphorylation, internalization, and down-regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) lacks the 5' exon, but has an additional exon in the 5' region, as compared to variant 1. Variants 1-4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:PAF Receptor (PTAFR) (NM_001164723) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228832 PTAFR (Myc-DDK-tagged)-Human platelet-activating factor receptor (PTAFR), transcript variant 4 10 ug
$457.00
RC228832L3 Lenti ORF clone of Human platelet-activating factor receptor (PTAFR), transcript variant 4, Myc-DDK-tagged 10 ug
$757.00
RC228832L4 Lenti ORF clone of Human platelet-activating factor receptor (PTAFR), transcript variant 4, mGFP tagged 10 ug
$757.00
RG228832 PTAFR (tGFP-tagged) - Human platelet-activating factor receptor (PTAFR), transcript variant 4 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.