PAF Receptor (PTAFR) (NM_001164723) Human Untagged Clone
SKU
SC327467
PTAFR (untagged)-Human platelet-activating factor receptor (PTAFR) transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PAF Receptor |
Synonyms | PAFR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC327467 representing NM_001164723.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGCCACATGACTCCTCCCACATGGACTCTGAGTTCCGATACACTCTCTTCCCGATTGTTTACAGC ATCATCTTTGTGCTCGGGGTCATTGCTAATGGCTACGTGCTGTGGGTCTTTGCCCGCCTGTACCCTTGC AAGAAATTCAATGAGATAAAGATCTTCATGGTGAACCTCACCATGGCGGACATGCTCTTCTTGATCACC CTGCCACTTTGGATTGTCTACTACCAAAACCAGGGCAACTGGATACTCCCCAAATTCCTGTGCAACGTG GCTGGCTGCCTTTTCTTCATCAACACCTACTGCTCTGTGGCCTTCCTGGGCGTCATCACTTATAACCGC TTCCAGGCAGTAACTCGGCCCATCAAGACTGCTCAGGCCAACACCCGCAAGCGTGGCATCTCTTTGTCC TTGGTCATCTGGGTGGCCATTGTGGGAGCTGCATCCTACTTCCTCATCCTGGACTCCACCAACACAGTG CCCGACAGTGCTGGCTCAGGCAACGTCACTCGCTGCTTTGAGCATTACGAGAAGGGCAGCGTGCCAGTC CTCATCATCCACATCTTCATCGTGTTCAGCTTCTTCCTGGTCTTCCTCATCATCCTCTTCTGCAACCTG GTCATCATCCGTACCTTGCTCATGCAGCCGGTGCAGCAGCAGCGCAACGCTGAAGTCAAGCGCCGGGCG CTGTGGATGGTGTGCACGGTCTTGGCGGTGTTCATCATCTGCTTCGTGCCCCACCACGTGGTGCAGCTG CCCTGGACCCTTGCTGAGCTGGGCTTCCAGGACAGCAAATTCCACCAGGCCATTAATGATGCACATCAG GTCACCCTCTGCCTCCTTAGCACCAACTGTGTCTTAGACCCTGTTATCTACTGTTTCCTCACCAAGAAG TTCCGCAAGCACCTCACCGAAAAGTTCTACAGCATGCGCAGTAGCCGGAAATGCTCCCGGGCCACCACG GATACGGTCACTGAAGTGGTTGTGCCATTCAACCAGATCCCTGGCAATTCCCTCAAAAATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001164723 |
Insert Size | 1029 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001164723.2 |
RefSeq Size | 4318 bp |
RefSeq ORF | 1029 bp |
Locus ID | 5724 |
UniProt ID | P25105 |
Cytogenetics | 1p35.3 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction |
MW | 39.2 kDa |
Summary | This gene encodes a seven-transmembrane G-protein-coupled receptor for platelet-activating factor (PAF) that localizes to lipid rafts and/or caveolae in the cell membrane. PAF (1-0-alkyl-2-acetyl-sn-glycero-3-phosphorylcholine) is a phospholipid that plays a significant role in oncogenic transformation, tumor growth, angiogenesis, metastasis, and pro-inflammatory processes. Binding of PAF to the PAF-receptor (PAFR) stimulates numerous signal transduction pathways including phospholipase C, D, A2, mitogen-activated protein kinases (MAPKs), and the phosphatidylinositol-calcium second messenger system. Following PAFR activation, cells become rapidly desensitized and this refractory state is dependent on PAFR phosphorylation, internalization, and down-regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (4) lacks the 5' exon, but has an additional exon in the 5' region, as compared to variant 1. Variants 1-4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC228832 | PTAFR (Myc-DDK-tagged)-Human platelet-activating factor receptor (PTAFR), transcript variant 4 | 10 ug |
$457.00
|
|
RC228832L3 | Lenti ORF clone of Human platelet-activating factor receptor (PTAFR), transcript variant 4, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC228832L4 | Lenti ORF clone of Human platelet-activating factor receptor (PTAFR), transcript variant 4, mGFP tagged | 10 ug |
$757.00
|
|
RG228832 | PTAFR (tGFP-tagged) - Human platelet-activating factor receptor (PTAFR), transcript variant 4 | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.