NEK6 (NM_001166168) Human Untagged Clone

SKU
SC327453
NEK6 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6) transcript variant 5
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NEK6
Synonyms SID6-1512
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327453 representing NM_001166168.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGGACAGCCCGGCCACATGCCCCATGGAGGGAGTTCCAACAACCTCTGCCACACCCTGGGGCCT
GTGCATCCTCCTGACCCACAGAGGCATCCCAACACGCTGTCTTTTCGCTGCTCGCTGGCGGACTTCCAG
ATCGAAAAGAAGATAGGCCGAGGACAGTTCAGCGAGGTGTACAAGGCCACCTGCCTGCTGGACAGGAAG
ACAGTGGCTCTGAAGAAGGTGCAGATCTTTGAGATGATGGACGCCAAGGCGAGGCAGGACTGTGTCAAG
GAGATCGGCCTCTTGAAGCAACTGAACCACCCAAATATCATCAAGTATTTGGACTCGTTTATCGAAGAC
AACGAGCTGAACATTGTGCTGGAGTTGGCTGACGCAGGGGACCTCTCGCAGATGATCAAGTACTTTAAG
AAGCAGAAGCGGCTCATCCCGGAGAGGACAGTATGGAAGTACTTTGTGCAGCTGTGCAGCGCCGTGGAG
CACATGCATTCACGCCGGGTGATGCACCGAGACATCAAGCCTGCCAACGTGTTCATCACAGCCACGGGC
GTCGTGAAGCTCGGTGACCTTGGTCTGGGCCGCTTCTTCAGCTCTGAGACCACCGCAGCCCACTCCCTA
GTGGGGACGCCCTACTACATGTCACCGGAGAGGATCCATGAGAACGGCTACAACTTCAAGTCCGACATC
TGGTCCCTGGGCTGTCTGCTGTACGAGATGGCAGCCCTCCAGAGCCCCTTCTATGGAGATAAGATGAAT
CTCTTCTCCCTGTGCCAGAAGATCGAGCAGTGTGACTACCCCCCACTCCCCGGGGAGCACTACTCCGAG
AAGTTACGAGAACTGGTCAGCATGTGCATCTGCCCTGACCCCCACCAGAGACCTGACATCGGATACGTG
CACCAGGTGGCCAAGCAGATGCACATCTGGATGTCCAGCACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001166168
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001166168.1
RefSeq Size 2587 bp
RefSeq ORF 942 bp
Locus ID 10783
UniProt ID Q9HC98
Cytogenetics 9q33.3
Protein Families Druggable Genome, Protein Kinase
MW 35.7 kDa
Summary The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Variants 2, 5 and 6 encode the same isoform (2).
Write Your Own Review
You're reviewing:NEK6 (NM_001166168) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228818 NEK6 (Myc-DDK-tagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 5 10 ug
$300.00
RC228818L3 Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 5, Myc-DDK-tagged 10 ug
$600.00
RC228818L4 Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 5, mGFP tagged 10 ug
$600.00
RG228818 NEK6 (tGFP-tagged) - Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 5 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.