NRG3 (NM_001165973) Human Untagged Clone

SKU
SC327049
NRG3 (untagged)-Human neuregulin 3 (NRG3) transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NRG3
Synonyms HRG3; pro-NRG3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327049 representing NM_001165973.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGTGTGGTATACCTCCAACCCTTGTATGCGTTGGGAGAGGAGGGGGACTACACACGATCAATATA
ATCATCTGGTATTATTTTCCTTCTGCCTGGAGGACTTGCTTTAACATTTCAAGTAGTGTGGGTCTGCTG
CTGACGAATTCATACAAATTTTATACGACGACATATTCCACAGAGCGATCCGAGCACTTCAAACCCTGC
CGAGACAAGGACCTTGCATACTGTCTCAATGATGGCGAGTGCTTTGTGATCGAAACCCTGACCGGATCC
CATAAACACTGTCGGTGCAAAGAAGGCTACCAAGGAGTCCGTTGTGATCAATTTCTGCCGAAAACTGAT
TCCATCTTATCGGATCCAACAGACCACTTGGGGATTGAATTCATGGAGAGTGAAGAAGTTTATCAAAGG
CAGGTGCTGTCAATTTCATGTATCATCTTTGGAATTGTCATCGTGGGCATGTTCTGTGCAGCATTCTAC
TTCAAAAGCAAGAAACAAGCTAAACAAATCCAAGAGCAGCTGAAAGTGCCACAAAATGGTAAAAGCTAC
AGTCTCAAAGCATCCAGCACAATGGCAAAGTCAGAGAACTTGGTGAAGAGCCATGTCCAGCTGCAAAAT
TATTCAAAGGTGGAAAGGCATCCTGTGACTGCATTGGAGAAAATGATGGAGTCAAGTTTTGTCGGCCCC
CAGTCATTCCCTGAGGTCCCTTCTCCTGACAGAGGAAGCCAGTCTGTCAAACACCACAGGAGTCTATCC
TCTTGCTGCAGCCCAGGGCAAAGAAGTGGCATGCTCCATAGGAATGCCTTCAGAAGGACACCCCCGTCA
CCCCGAAGTAGGCTAGGTGGAATTGTGGGACCAGCATATCAGCAACTCGAAGAATCAAGGATCCCAGAC
CAGGATACGATACCTTGCCAAGGGATAGAGGTCAGGAAGACTATATCCCACCTGCCTATACAGCTGTGG
TGTGTTGAAAGACCCCTGGACTTAAAGTATTCATCCAGTGGTTTAAAAACCCAACGAAATACATCAATA
AATATGCAACTGCCTTCAAGAGAGACAAACCCCTATTTTAATAGCTTGGAGCAAAAGGACCTGGTGGGC
TATTCATCCACAAGGGCCAGTTCTGTGCCCATCATCCCTTCAGTGGGTTTAGAGGAAACCTGCCTGCAA
ATGCCAGGGATTTCTGAAGTCAAAAGCATCAAATGGTGCAAAAACTCCTATTCAGCTGACGTTGTCAAT
GTGAGTATTCCAGTCAGCGATTGTCTTATAGCAGAACAACAAGAAGTGAAAATATTGCTAGAAACTGTC
CAGGAGCAGATCCGAATTCTGACTGATGCCAGACGGTCAGAAGACTACGAACTGGCCAGCGTAGAAACC
GAGGACAGTGCAAGCGAAAACACAGCCTTTCTCCCCCTGAGTCCCACAGCCAAATCAGAACGAGAGGCG
CAATTTGTCTTAAGAAATGAAATACAAAGAGACTCTGCATTGACCAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001165973
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001165973.1
RefSeq Size 3348 bp
RefSeq ORF 1500 bp
Locus ID 10718
UniProt ID P56975
Cytogenetics 10q23.1
Protein Families Druggable Genome, Transmembrane
Protein Pathways ErbB signaling pathway
MW 56 kDa
Summary This gene is a member of the neuregulin gene family. This gene family encodes ligands for the transmembrane tyrosine kinase receptors ERBB3 and ERBB4 - members of the epidermal growth factor receptor family. Ligand binding activates intracellular signaling cascades and the induction of cellular responses including proliferation, migration, differentiation, and survival or apoptosis. This gene encodes neuregulin 3 (NRG3). NRG3 has been shown to activate the tyrosine phosphorylation of its cognate receptor, ERBB4, and is thought to influence neuroblast proliferation, migration and differentiation by signalling through ERBB4. NRG3 also promotes mammary differentiation during embryogenesis. Linkage studies have implicated this gene as a susceptibility locus for schizophrenia and schizoaffective disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but their biological validity has not been verified.[provided by RefSeq, Sep 2009]
Transcript Variant: This variant (3) has multiple differences in the presence and absence of exons in the 5' and 3' ends, compared to variant 1. These differences produce a unique 5' UTR and cause translation initiation at a unique start codon, compared to variant 1. The encoded protein (isoform 3; also known as hFBNRG3) has a shorter and distinct N-terminus and 24 additional aa in its C-terminus, compared to isoform 1. Isoform 3 is exclusively expressed in fetal brain and may undergo N-terminal proteolytic processing following its insertion into the plasma membrane.
Write Your Own Review
You're reviewing:NRG3 (NM_001165973) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228414 NRG3 (Myc-DDK-tagged)-Human neuregulin 3 (NRG3), transcript variant 3 10 ug
$457.00
RC228414L3 Lenti ORF clone of Human neuregulin 3 (NRG3), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC228414L4 Lenti ORF clone of Human neuregulin 3 (NRG3), transcript variant 3, mGFP tagged 10 ug
$757.00
RG228414 NRG3 (tGFP-tagged) - Human neuregulin 3 (NRG3), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.