Alpha 2 Antiplasmin (SERPINF2) (NM_001165921) Human Untagged Clone

SKU
SC326977
SERPINF2 (untagged)-Human serpin peptidase inhibitor clade F (alpha-2 antiplasmin pigment epithelium derived factor) member 2 (SERPINF2) transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Alpha 2 Antiplasmin
Synonyms A2AP; AAP; ALPHA-2-PI; alpha2AP; API; PLI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326977 representing NM_001165921.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTGCTCTGGGGGCTCCTGGTGCTCAGCTGGTCCTGCCTGCAAGGCCCCTGCTCCGTGTTCTCC
CCTGTGAGCGCCATGGAGCCCTTGGGCCGGCAGCTAACTAGCGGGCCGAACCAGGAGCAGGTGTCCCCA
CTTACCCTCCTCAAGTTGGGCAACCAGGTACAACCAGGTGCTCAGAACCACACGTTGCAGAGGCTGCAA
CAGGTGCTGCACGCAGGCTCAGGGCCCTGCCTCCCCCATCTGCTGAGCCGCCTCTGCCAGGACCTGGGC
CCCGGCGCGTTCCGACTGGCTGCCAGGATGTACCTGCAGAAAGGATTTCCCATCAAAGAAGATTTCCTG
GAACAATCCGAACAGCTATTTGGGGCAAAGCCCGTGAGCCTGACGGGAAAGCAGGAAGATGACCTGGCA
AACATCAACCAATGGGTGAAGGAGGCCACGGAGGGGAAGATTCAGGAATTCCTCTCTGGGCTGCCGGAA
GACACCGTGTTGCTTCTCCTCAACGCCATCCACTTCCAGGGTTTCTGGAGGAACAAGTTTGACCCGAGC
CTTACCCAGAGAGACTCCTTCCACCTGGACGAGCAGTTCACGGTGCCCGTGGAAATGATGCAGGCCCGC
ACGTACCCGCTGCGCTGGTTCTTGCTGGAGCAGCCTGAGATCCAGGTGGCTCATTTCCCCTTTAAGAAC
AACATGAGCTTTGTGGTCCTTGTACCCACCCACTTTGAATGGAACGTGTCCCAGGTACTGGCCAACCTG
AGTTGGGACACCCTGCACCCACCTCTGGTGTGGGAGAGGCCCACCAAGGTCCGGCTGCCTAAGCTGTAT
CTGAAACACCAAATGGACCTGGTGGCCACCCTCAGCCAGCTGGGCCTGCAGGAGTTGTTCCAGGCCCCA
GACCTGCGTGGGATCTCCGAGCAGAGCCTGGTGGTGTCCGGCGTGCAGCATCAGTCCACCCTGGAGCTC
AGCGAGGTCGGCGTGGAGGCGGCGGCGGCCACCAGCATTGCCATGTCCCGCATGTCCCTGTCCTCCTTC
AGCGTGAACCGCCCCTTCCTCTTCTTCATCTTCGAGGACACCACAGGCCTTCCCCTCTTCGTGGGCAGC
GTGAGGAACCCCAACCCCAGTGCACCGCGGGAGCTCAAGGAACAGCAGGATTCCCCGGGCAACAAGGAC
TTCCTCCAGAGCCTGAAAGGCTTCCCCCGCGGAGACAAGCTTTTCGGCCCTGACTTAAAACTTGTGCCC
CCCATGGAGGAGGATTACCCCCAGTTTGGCAGCCCCAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001165921
Insert Size 1284 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001165921.1
RefSeq Size 2126 bp
RefSeq ORF 1284 bp
Locus ID 5345
UniProt ID P08697
Cytogenetics 17p13.3
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Complement and coagulation cascades
MW 47.9 kDa
Summary This gene encodes a member of the serpin family of serine protease inhibitors. The protein is a major inhibitor of plasmin, which degrades fibrin and various other proteins. Consequently, the proper function of this gene has a major role in regulating the blood clotting pathway. Mutations in this gene result in alpha-2-plasmin inhibitor deficiency, which is characterized by severe hemorrhagic diathesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (3) uses an alternate splice site and lacks an alternate exon in the 5' coding region, compared to variant 1. The resulting isoform (b) lacks an internal segment, compared to isoform a.
Write Your Own Review
You're reviewing:Alpha 2 Antiplasmin (SERPINF2) (NM_001165921) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228342 SERPINF2 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 (SERPINF2), transcript variant 3 10 ug
$457.00
RC228342L3 Lenti ORF clone of Human serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 (SERPINF2), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC228342L4 Lenti ORF clone of Human serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 (SERPINF2), transcript variant 3, mGFP tagged 10 ug
$757.00
RG228342 SERPINF2 (tGFP-tagged) - Human serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 (SERPINF2), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.