Perilipin 3 (PLIN3) (NM_001164194) Human Untagged Clone

SKU
SC326974
PLIN3 (untagged)-Human perilipin 3 (PLIN3) transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Perilipin 3
Synonyms M6PRBP1; PP17; TIP47
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326974 representing NM_001164194.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTGCCGACGGGGCAGAGGCTGATGGCAGCACCCAGGTGACAGTGGAAGAACCGGTACAGCAGCCC
AGTGTGGTGGACCGTGTGGCCAGCATGCCTCTGATCAGCTCCACCTGCGACATGGTGTCCGCAGCCTAT
GCCTCCACCAAGGAGAGCTACCCGCACATCAAGACTGTCTGCGACGCAGCAGAGAAGGGAGTGAGGACC
CTCACGGCGGCTGCTGTCAGCGGGGCTCAGCCGATCCTCTCCAAGCTGGAGCCCCAGATTGCATCAGCC
AGCGAATACGCCCACAGGGGGCTGGACAAGTTGGAGGAGAACCTCCCCATCCTGCAGCAGCCCACGGAG
AAGGTGTCGGGGGCCCAAGAGATGGTGTCTAGCGCCAAGGACACGGTGGCCACCCAATTGTCGGAGGCG
GTGGACGCGACCCGCGGTGCTGTGCAGAGCGGCGTGGACAAGACAAAGTCCGTAGTGACCGGCGGCGTC
CAATCGGTCATGGGCTCCCGCTTGGGCCAGATGGTGTTGAGTGGGGTCGACACGGTGCTGGGGAAGTCG
GAGGAGTGGGCGGACAACCACCTGCCCCTTACGGATGCCGAACTGGCCCGCATCGCCACATCCCTGGAT
GGCTTTGACGTCGCGTCCGTGCAGCAGCAGCGGCAGGAACAGAGCTACTTCGTACGTCTGGGCTCCCTG
TCGGAGAGGCTGCGGCAGCACGCCTATGAGCACTCGCTGGGCAAGCTTCGAGCCACCAAGCAGAGGGCA
CAGGAGGCTCTGCTGCAGCTGTCGCAGGTCCTAAGCCTGATGGAAACTGTCAAGCAAGGCGTTGATCAG
AAGCTGGTGGAAGGCCAGGAGAAGCTGCACCAGATGTGGCTCAGCTGGAACCAGAAGCAGCTCCAGGGC
CCCGAGAAGGAGCCGCCCAAGCCAGAGCAGGTCGAGTCCCGGGCGCTCACCATGTTCCGGGACATTGCC
CAGCAACTGCAGGCCACCTGTACCTCCCTGGGGTCCAGCATTCAGGGCCTCCCCACCAATGTGAAGGAC
CAGGTGCAGCAGGCCCGCCGCCAGGTGGAGGACCTCCAGGCCACGTTTTCCAGCATCCACTCCTTCCAG
GACCTGTCCAGCAGCATTCTGGCCCAGAGCCGTGAGCGTGTCGCCAGCGCCCGCGAGGCCCTGGACCAC
ATGGTGGAATATGTGGCCCAGAACACACCTGTCACGTGGCTCGTGGGACCCTTTGCCCCTGGAATCACT
GAGAAAGCCCCGGAGGAGAAGAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001164194
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001164194.1
RefSeq Size 2304 bp
RefSeq ORF 1269 bp
Locus ID 10226
UniProt ID O60664
Cytogenetics 19p13.3
Protein Families Druggable Genome
MW 45.8 kDa
Summary Mannose 6-phophate receptors (MPRs) deliver lysosomal hydrolase from the Golgi to endosomes and then return to the Golgi complex. The protein encoded by this gene interacts with the cytoplasmic domains of both cation-independent and cation-dependent MPRs, and is required for endosome-to-Golgi transport. This protein also binds directly to the GTPase RAB9 (RAB9A), a member of the RAS oncogene family. The interaction with RAB9 has been shown to increase the affinity of this protein for its cargo. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2009]
Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Perilipin 3 (PLIN3) (NM_001164194) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228339 PLIN3 (Myc-DDK-tagged)-Human perilipin 3 (PLIN3), transcript variant 3 10 ug
$457.00
RC228339L3 Lenti ORF clone of Human perilipin 3 (PLIN3), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC228339L4 Lenti ORF clone of Human perilipin 3 (PLIN3), transcript variant 3, mGFP tagged 10 ug
$757.00
RG228339 PLIN3 (tGFP-tagged) - Human perilipin 3 (PLIN3), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.