5 HT 2A (HTR2A) (NM_001165947) Human Untagged Clone

SKU
SC326947
HTR2A (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A) transcript variant 2
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol 5 HT 2A
Synonyms 5-HT2A; HTR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326947 representing NM_001165947.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGTTTTTGAAGTCAGCAAAACAGAAACCAAATTACTATCATATTATGCTGGTGGAAGATCAAGAA
GAGGGGACTCTACACCAGTTTAATTACTGTGAGAGATGCAGCGAGTCACAGAATAACAAATGTATCTCA
TGTGTGGACCCTGAAGACAAATGGTACCGGTGGCCTCTGCCGAGCAAGCTTTGTGCAGTCTGGATTTAC
CTGGACGTGCTCTTCTCCACGGCCTCCATCATGCACCTCTGCGCCATCTCGCTGGACCGCTACGTCGCC
ATCCAGAATCCCATCCACCACAGCCGCTTCAACTCCAGAACTAAGGCATTTCTGAAAATCATTGCTGTT
TGGACCATATCAGTAGGTATATCCATGCCAATACCAGTCTTTGGGCTACAGGACGATTCGAAGGTCTTT
AAGGAGGGGAGTTGCTTACTCGCCGATGATAACTTTGTCCTGATCGGCTCTTTTGTGTCATTTTTCATT
CCCTTAACCATCATGGTGATCACCTACTTTCTAACTATCAAGTCACTCCAGAAAGAAGCTACTTTGTGT
GTAAGTGATCTTGGCACACGGGCCAAATTAGCTTCTTTCAGCTTCCTCCCTCAGAGTTCTTTGTCTTCA
GAAAAGCTCTTCCAGCGGTCGATCCATAGGGAGCCAGGGTCCTACACAGGCAGGAGGACTATGCAGTCC
ATCAGCAATGAGCAAAAGGCATGCAAGGTGCTGGGCATCGTCTTCTTCCTGTTTGTGGTGATGTGGTGC
CCTTTCTTCATCACAAACATCATGGCCGTCATCTGCAAAGAGTCCTGCAATGAGGATGTCATTGGGGCC
CTGCTCAATGTGTTTGTTTGGATCGGTTATCTCTCTTCAGCAGTCAACCCACTAGTCTACACACTGTTC
AACAAGACCTATAGGTCAGCCTTTTCACGGTATATTCAGTGTCAGTACAAGGAAAACAAAAAACCATTG
CAGTTAATTTTAGTGAACACAATACCGGCTTTGGCCTACAAGTCTAGCCAACTTCAAATGGGACAAAAA
AAGAATTCAAAGCAAGATGCCAAGACAACAGATAATGACTGCTCAATGGTTGCTCTAGGAAAGCAGCAT
TCTGAAGAGGCTTCTAAAGACAATAGCGACGGAGTGAATGAAAAGGTGAGCTGTGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001165947
Insert Size 1164 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001165947.2
RefSeq Size 4702 bp
RefSeq ORF 1164 bp
Locus ID 3356
UniProt ID P28223
Cytogenetics 13q14.2
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Gap junction, Neuroactive ligand-receptor interaction
MW 43.9 kDa
Summary This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 1, that causes translation initiation at an upstream AUG. The resulting protein (isoform 2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:5 HT 2A (HTR2A) (NM_001165947) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228312 HTR2A (Myc-DDK-tagged)-Human 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), transcript variant 2 10 ug
$457.00
RC228312L1 Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC228312L2 Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), transcript variant 2, mGFP tagged 10 ug
$757.00
RC228312L3 Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC228312L4 Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), transcript variant 2, mGFP tagged 10 ug
$757.00
RG228312 HTR2A (tGFP-tagged) - Human 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.