Sex Hormone Binding Globulin (SHBG) (NM_001146279) Human Untagged Clone

SKU
SC326942
SHBG (untagged)-Human sex hormone-binding globulin (SHBG) transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Sex Hormone Binding Globulin
Synonyms ABP; SBP; TEBG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326942 representing NM_001146279.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAGCAGAGGCCCACTGGCTACCTCGCGCCTGCTGCTGTTGCTGCTGTTGCTACTACTGCGTCAC
ACCCGCCAGGGATGGGCCCTGAGACCTGTTCTCCCCACCCAGAGTGCCCACGACCCTCCGGCTGTCCAC
CTCAGCAATGGCCCAGGACAAGAGCCTATCGCTGTCATGACCTTTGACCTCACCAAGATCACAAAAACC
TCCTCCTCCTTTGAGGTTCGAACCTGGGACCCAGAGGGAGTGATTTTTTATGGGGATACCAACCCTAAG
GATGACTGGTTTATGCTGGGACTTCGAGACGGCAGGCCTGAGATCCAACTGCACAATCACTGGGCCCAG
CTTACGGTGGGTGCTGGACCACGGCTGGATGATGGGAGATGGCACCAGGTGGAAGTCAAGATGGAGGGG
GACTCTGTGCTGCTGGAGGTGGATGGGGAGGAGGTGCTGCGCCTGAGACAGGTCTCTGGGCCCCTGACC
AGCAAACGCCATCCCATCATGAGGATTGCGCTTGGGGGGCTGCTCTTCCCCGCTTCCAACCTTCGGTTG
CCGGCCGAGATCTCAGCATCTGCCCCCACTAGCCTCAGAAGCTGTGATGTAGAATCAAATCCCGGGATA
TTTCTCCCTCCAGGGACTCAGGCAGAATTCAATCTCCGAGACATTCCCCAGCCTCATGCAGAGCCCTGG
GCCTTCTCTTTGGACCTGGGACTCAAGCAGGCAGCAGGCTCAGGCCACCTCCTTGCTCTTGGGACACCA
GAGAACCCATCTTGGCTCAGTCTCCACCTCCAAGATCAAAAGGTGGTGTTGTCTTCTGGGTCGGGGCCA
GGGCTGGATCTGCCCCTGGTCTTGGGACTCCCTCTTCAGCTGAAGCTGAGTATGTCCAGGGTGGTCTTG
AGCCAAGGGTCGAAGATGAAGGCCCTTGCCCTGCCTCCCTTAGGCCTGGCTCCCCTCCTTAACCTCTGG
GCCAAGCCTCAAGGGCGTCTCTTCCTGGGGGCTTTACCAGGAGAAGACTCTTCCACCTCTTTTTGCCTG
AATGGCCTTTGGGCACAAGGTCAGAGGCTGGATGTGGACCAGGCCCTGAACAGAAGCCATGAGATCTGG
ACTCACAGCTGCCCCCAGAGCCCAGGCAATGGCACTGACGCTTCCCATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001146279
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001146279.2
RefSeq Size 1279 bp
RefSeq ORF 1155 bp
Locus ID 6462
UniProt ID P04278
Cytogenetics 17p13.1
Protein Families Druggable Genome, Secreted Protein
MW 41.7 kDa
Summary This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein transports androgens and estrogens in the blood, binding each steroid molecule as a dimer formed from identical or nearly identical monomers. Polymorphisms in this gene have been associated with polycystic ovary syndrome and type 2 diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. The encoded isoform (2) is shorter compared to isoform 1.
Write Your Own Review
You're reviewing:Sex Hormone Binding Globulin (SHBG) (NM_001146279) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228307 SHBG (Myc-DDK-tagged)-Human sex hormone-binding globulin (SHBG), transcript variant 2 10 ug
$457.00
RC228307L3 Lenti ORF clone of Human sex hormone-binding globulin (SHBG), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC228307L4 Lenti ORF clone of Human sex hormone-binding globulin (SHBG), transcript variant 2, mGFP tagged 10 ug
$757.00
RG228307 SHBG (tGFP-tagged) - Human sex hormone-binding globulin (SHBG), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.