Tropomodulin 1 (TMOD1) (NM_001166116) Human Untagged Clone

SKU
SC326926
TMOD1 (untagged)-Human tropomodulin 1 (TMOD1) transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Tropomodulin 1
Synonyms D9S57E; ETMOD; TMOD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326926 representing NM_001166116.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGTACAGACGAGAACTAGAGAAATACCGTGACCTGGATGAAGATGAAATCCTTGGAGCCCTAACA
GAGGAAGAGCTGAGGACCCTGGAAAATGAGCTGGATGAGCTGGACCCTGATAATGCACTGCTGCCTGCA
GGCCTGAGGCAGAAGGATCAGACCACCAAGGCGCCCACGGGCCCCTTTAAAAGAGAGGAGCTCTTGGAT
CACTTGGAAAAGCAAGCAAAGGAGTTTAAGGACCGAGAAGATCTGGTCCCCTACACAGGGGAAAAACGA
GGAAAGGTCTGGGTTCCTAAGCAGAAGCCACTGGATCCTGTGCTGGAAAGTGTGACGCTGGAACCGGAG
CTGGAGGAAGCCTTGGCAAATGCTTCAGATGCAGAACTCTGTGACATTGCAGCGATCCTGGGCATGCAC
ACGCTCATGAGTAACCAGCAGTACTACCAGGCCCTGAGCAGCAGCTCCATCATGAACAAGGAGGGGCTC
AACAGCGTGATTAAACCCACACAATACAAGCCTGTGCCCGACGAAGAACCAAATTCAACAGACGTAGAG
GAAACGCTGGAACGGATAAAGAACAACGACCCAAAACTTGAAGAAGTTAACCTCAATAATATCCGGAAT
ATCCCCATCCCCACCCTCAAGGCATATGCAGAAGCCCTGAAAGAAAACTCATATGTGAAGAAGTTCAGC
ATCGTGGGGACACGGAGTAATGACCCCGTGGCGTATGCCCTTGCTGAGATGCTCAAGGAGAACAAGGTG
TTGAAGACACTGAATGTGGAATCCAACTTCATTTCTGGAGCTGGGATTCTGCGCCTGGTAGAAGCCCTC
CCATACAACACTTCTCTGGTGGAAATGAAAATTGACAACCAGAGCCAGCCCCTGGGCAACAAAGTGGAA
ATGGAGATTGTGAGCATGTTGGAAAAAAACGCAACACTTCTCAAATTCGGCTACCACTTTACCCAGCAA
GGACCCCGGCTTCGGGCATCCAACGCAATGATGAACAACAATGACCTTGTGAGGAAGAGGAGGCTTGCG
GACCTGACTGGGCCCATCATTCCCAAGTGCCGGAGTGGTGTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001166116
Insert Size 1080 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001166116.1
RefSeq Size 3275 bp
RefSeq ORF 1080 bp
Locus ID 7111
UniProt ID P28289
Cytogenetics 9q22.33
MW 40.6 kDa
Summary This gene encodes a member of the tropomodulin family. The encoded protein is an actin-capping protein that regulates tropomyosin by binding to its N-terminus, inhibiting depolymerization and elongation of the pointed end of actin filaments and thereby influencing the structure of the erythrocyte membrane skeleton. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:Tropomodulin 1 (TMOD1) (NM_001166116) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228291 TMOD1 (Myc-DDK-tagged)-Human tropomodulin 1 (TMOD1), transcript variant 2 10 ug
$457.00
RC228291L3 Lenti ORF clone of Human tropomodulin 1 (TMOD1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC228291L4 Lenti ORF clone of Human tropomodulin 1 (TMOD1), transcript variant 2, mGFP tagged 10 ug
$757.00
RG228291 TMOD1 (tGFP-tagged) - Human tropomodulin 1 (TMOD1), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.