SUMF1 (NM_001164675) Human Untagged Clone

SKU
SC326918
SUMF1 (untagged)-Human sulfatase modifying factor 1 (SUMF1) transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SUMF1
Synonyms AAPA3037; FGE; UNQ3037
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326918 representing NM_001164675.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCGCCCGCACTAGGGCTGGTGTGTGGACGTTGCCCTGAGCTGGGTCTCGTCCTCTTGCTGCTG
CTGCTCTCGCTGCTGTGTGGAGCGGCAGGGAGCCAGGAGGCCGGGACCGGTGCGGGCGCGGGGTCCCTT
GCGGGTTCTTGCGGCTGCGGCACGCCCCAGCGGCCTGGCGCCCATGGCAGTTCGGCAGCCGCTCACCGA
TACTCGCGGGAGGCTAACGCTCCGGGCCCCGTACCCGGAGAGCGGCAACTCGCGCACTCAAAGATGGTC
CCCATCCCTGCTGGAGTATTTACAATGGGCACAGATGATCCTCAGATAAAGCAGGATGGGGAAGCACCT
GCGAGGAGAGTTACTATTGATGCCTTTTACATGGATGCCTATGAAGTCAGTAATACTGAATTTGAGAAG
TTTGTGAACTCAACTGGCTATTTGACAGAGGCTGAGAAGTTTGGCGACTCCTTTGTCTTTGAAGGCATG
TTGAGTGAGCAAGTGAAGACCAATATTCAACAGGCAGTTGCAGCTGCTCCCTGGTGGTTACCTGTGAAA
GGCGCTAACTGGAGACACCCAGAAGGGCCTGACTCTACTATTCTGCACAGGCCGGATCATCCAGTTCTC
CATGTGTCCTGGAATGATGCGGTTGCCTACTGCACTTGGGCAGGGAAGCGGCTGCCCACGGAAGCTGAG
TGGGAATACAGCTGTCGAGGAGGCCTGCATAATAGACTTTTCCCCTGGGGCAACAAACTGCAGCCCAAA
GGCCAGCATTATGCCAACATTTGGCAGGGCGAGTTTCCGGTGACCAACACTGGTGAGGATGGCTTCCAA
GGAACTGCGCCTGTTGATGCCTTCCCTCCCAATGGTTATGGCTTATACAACATAGTGGGGAACGCATGG
GAATGGACTTCAGACTGGTGGACTGTTCATCATTCTGTTGAAGAAACGCTTAACCCATCTTATTGTTAC
AGGTATCGCTGTGCTGCTCGGAGCCAGAACACACCTGATAGCTCTGCTTCGAATCTGGGATTCCGCTGT
GCAGCCGACCGCCTGCCCACTATGGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001164675
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001164675.1
RefSeq Size 2119 bp
RefSeq ORF 1065 bp
Locus ID 285362
UniProt ID Q8NBK3
Cytogenetics 3p26.1
MW 38.4 kDa
Summary This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (3) that is shorter than isoform 1.
Write Your Own Review
You're reviewing:SUMF1 (NM_001164675) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228283 SUMF1 (Myc-DDK-tagged)-Human sulfatase modifying factor 1 (SUMF1), transcript variant 3 10 ug
$457.00
RC228283L3 Lenti-ORF clone of SUMF1 (Myc-DDK-tagged)-Human sulfatase modifying factor 1 (SUMF1), transcript variant 3 10 ug
$757.00
RC228283L4 Lenti-ORF clone of SUMF1 (mGFP-tagged)-Human sulfatase modifying factor 1 (SUMF1), transcript variant 3 10 ug
$757.00
RG228283 SUMF1 (tGFP-tagged) - Human sulfatase modifying factor 1 (SUMF1), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.