ZDHHC15 (NM_001146256) Human Untagged Clone

SKU
SC326894
ZDHHC15 (untagged)-Human zinc finger DHHC-type containing 15 (ZDHHC15) transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ZDHHC15
Synonyms DHHC15; MRX91
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326894 representing NM_001146256.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGGCGAGGCTGGAAGATGGCTCTGTCTGGGGGGCTGCGGTGCTGCCGCCGGGTACTGTCCTGGGTG
CCAGTGCTCGTTATTGTCCTCGTCGTGCTCTGGTCCTACTATGCCTACGTCTTTGAACTCTGCCTGGTT
ATTTACCTCATACTCTACCATGCCATCTTTGTGTTCTTTACCTGGACCTACTGGAAGTCTATCTTTACA
CTCCCACAGCAGCCAAACCAGAAGTTCCACTTGTCCTACACAGACAAGGAGCGCTATGAAAATGAAGAA
AGACCTGAGGTCCAGAAGCAGATGCTTGTTGATATGGCCAAAAAGCTACCGGTTTACACAAGAACTGGA
AGTGGAGCTGTACGATTCTGTGACCGGTGTCATCTGATCAAGCCAGACCGCTGCCACCACTGCTCTGTC
TGTGCTATGTGTGTGTTAAAAATGGATCATCACTGCCCTTGGGTTAATAACTGCATTGGATTTTCCAAC
TACAAATTCTTCCTTCAATTCTTAGCTTACTCTGTTCTCTACTGCCTGTACATTGCTACGACAGTCTTC
AGCTATTTCATCAAATACTGGAGAGGGGAATTACCCAGTGTTCGCTCTAAGTTCCATGTCCTTTTTCTT
CTCTTTGTGGCCTGCATGTTTTTTGTCAGCCTTGTGATTCTCTTTGGTTACCATTGTTGGCTTGTCAGC
AGAAACAAAACCACCTTAGAGGCCTTCTGCACTCCAGTGTTTACAAGTGGCCCAGAGAAAAATGGGTTC
AACCTTGGCTTCATCAAGAATATCCAGCAGGTGTTTGGAGATAAGAAGAAGTTCTGGTTAATACCTATT
GGTTCCAGCCCTGGTGATGGACACTCCTTCCCTATGAGGTCTATGAATGAGTCACAGAACCCACTGCTA
GCAAATGAAGAAACCTGGGAAGACAACGAGGATGACAACCAAGATTATCCAGAAGGCTCATCATCTCTT
GCTGTGGAAACGGAAACATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001146256
Insert Size 987 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001146256.1
RefSeq Size 6030 bp
RefSeq ORF 987 bp
Locus ID 158866
UniProt ID Q96MV8
Cytogenetics Xq13.3
Protein Families Transmembrane
MW 38.4 kDa
Summary The protein encoded by this gene belongs to the DHHC palmitoyltransferase family. Mutations in this gene are associated with mental retardatio X-linked type 91 (MRX91). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) is lacking an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) missing a 9 aa segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:ZDHHC15 (NM_001146256) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228259 ZDHHC15 (Myc-DDK-tagged)-Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2 10 ug
$300.00
RC228259L1 Lenti ORF clone of Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC228259L2 Lenti ORF clone of Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2, mGFP tagged 10 ug
$600.00
RC228259L3 Lenti ORF clone of Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC228259L4 Lenti ORF clone of Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2, mGFP tagged 10 ug
$600.00
RG228259 ZDHHC15 (tGFP-tagged) - Human zinc finger, DHHC-type containing 15 (ZDHHC15), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.