Endothelin A Receptor (EDNRA) (NM_001166055) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Endothelin A Receptor |
Synonyms | ET-A; ETA; ETA-R; ETAR; ETRA; hET-AR; MFDA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC326886 representing NM_001166055.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAACCCTTTGCCTCAGGGCATCCTTTTGGCTGGCACTGGTTGGATGTGTAATCAGTGATAATCCT GAGAGATACAGCACAAATCTAAGCAATCATGTGGATGATTTCACCACTTTTCGTGGCACAGAGCTCAGC TTCCTGGTTACCACTCATCAACCCACTAATTTGGTCCTACCCAGCAATGGCTCAATGCACAACTATTGC CCACAGCAGACTAAAATTACTTCAGCTTTCAAATACATTAACACTGTGATATCTTGTACTATTTTCATC GTGGGAATGGTGGGGAATGCAACTCTGCTCAGGATCATTTACCAGAACAAATGTATGAGGAATGGCCCC AACGCGCTGATAGCCAGTCTTGCCCTTGGAGACCTTATCTATGTGGTCATTGATCTCCCTATCAATGTA TTTAAGTTCTACCAAGATGTAAAGGACTGGTGGCTCTTCGGGTTCTATTTCTGTATGCCCTTGGTGTGC ACTGCGATCTTCTACACCCTCATGACTTGTGAGATGTTGAACAGAAGGAATGGCAGCTTGAGAATTGCC CTCAGTGAACATCTTAAGCAGCGTCGAGAAGTGGCAAAAACAGTTTTCTGCTTGGTTGTAATTTTTGCT CTTTGCTGGTTCCCTCTTCATTTAAGCCGTATATTGAAGAAAACTGTGTATAACGAGATGGACAAGAAC CGATGTGAATTACTTAGTTTCTTACTGCTCATGGATTACATCGGTATTAACTTGGCAACCATGAATTCA TGTATAAACCCCATAGCTCTGTATTTTGTGAGCAAGAAATTTAAAAATTGTTTCCAGTCATGCCTCTGC TGCTGCTGTTACCAGTCCAAAAGTCTGATGACCTCGGTCCCCATGAACGGAACAAGCATCCAGTGGAAG AACCACGATCAAAACAACCACAACACAGACCGGAGCAGCCATAAGGACAGCATGAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166055 |
Insert Size | 957 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001166055.1 |
RefSeq Size | 3841 bp |
RefSeq ORF | 957 bp |
Locus ID | 1909 |
UniProt ID | P25101 |
Cytogenetics | 4q31.22-q31.23 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction, Vascular smooth muscle contraction |
MW | 36.5 kDa |
Summary | This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2, also known as ET-ARdelta3,4) lacks two alternate exons, resulting in the loss of an in-frame segment of the central coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC228251 | EDNRA (Myc-DDK-tagged)-Human endothelin receptor type A (EDNRA), transcript variant 2 | 10 ug |
$300.00
|
|
RC228251L3 | Lenti ORF clone of Human endothelin receptor type A (EDNRA), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC228251L4 | Lenti ORF clone of Human endothelin receptor type A (EDNRA), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG228251 | EDNRA (tGFP-tagged) - Human endothelin receptor type A (EDNRA), transcript variant 2 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.