Endomucin (EMCN) (NM_001159694) Human Untagged Clone

SKU
SC326814
EMCN (untagged)-Human endomucin (EMCN) transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Endomucin
Synonyms EMCN2; MUC14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326814 representing NM_001159694.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAACTGCTTCAAGTGACCATTCTTTTTCTTCTGCCCAGTATTTGCAGCAGTAACAGCACAGGTGTT
TTAGAGGCAGCTAATAATTCACTTGTTGTTACTACAACAAAACCATCTATAACAACACCAAACACAGAA
TCATTACAGAAAAATGTTGTCACACCAACAACTGGAACAACTCCTAAAGGAACAATCACCAATGAATTA
CTTAAAATGTCTCTGATGTCAACAGCTACTTTTTTAACAAGTAAAGATGAAGGATTGAAAGCCACAACC
ACTGATGTCAGGAAGAATGACTCCATCATTTCAAACGTAACAGTAACAAGTGTTACACTTCCAAATGCT
GTTTCAACATTACAAAGTTCCAAACCCAAGAGTAGTGTTCTACAACCAGATGCATCACCTTCTAAAACT
GGTACATTAACCTCAATACCAGTTACAATTCCAGAAAACACCTCACAGTCTCAAGTAATAGGCACTGAG
GGTGGAAAAAATGCAAGCACTTCAGCAACCAGCCGGTCTTATTCCAGTATTATTTTGCCGGTGGTTATT
GCTTTGATTGTAATAACACTTTCAGTATTTGTTCTGGTGGGTTTGTACCGAATGTGCTGGAAGGCAGAT
CCGGGCACACCAGAAAATGGAAATGATCAACCTCAGTCTGATAAAGAGAGCGTGAAGCTTCTTACCGTT
AAGACAATTTCTCATGAGTCTGGTGAGCACTCTGCACAAGGAAAAACCAAGAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001159694
Insert Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001159694.1
RefSeq Size 4008 bp
RefSeq ORF 747 bp
Locus ID 51705
UniProt ID Q9ULC0
Cytogenetics 4q24
Protein Families Transmembrane
MW 26.1 kDa
Summary EMCN is a mucin-like sialoglycoprotein that interferes with the assembly of focal adhesion complexes and inhibits interaction between cells and the extracellular matrix (Kinoshita et al., 2001 [PubMed 11418125]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) lacks an in-frame exon in the middle portion of the coding region compared to variant 1. This results in a shorter protein (isoform 2) compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Endomucin (EMCN) (NM_001159694) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228179 EMCN (Myc-DDK-tagged)-Human endomucin (EMCN), transcript variant 2 10 ug
$300.00
RC228179L3 Lenti ORF clone of Human endomucin (EMCN), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC228179L4 Lenti ORF clone of Human endomucin (EMCN), transcript variant 2, mGFP tagged 10 ug
$600.00
RG228179 EMCN (tGFP-tagged) - Human endomucin (EMCN), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.