MTFR1 (NM_001145838) Human Untagged Clone

SKU
SC326553
MTFR1 (untagged)-Human mitochondrial fission regulator 1 (MTFR1), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MTFR1
Synonyms CHPPR; FAM54A2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326553 representing NM_001145838.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTTGGCTGGATTAAGCGCCTAATTAGGATGGTTTTTCAACAAGTTGGAGTAAGCATGCAATCGATT
AACAGCCATGCAACAGAATGGAGTCCCAGCCACCCAGGAGAGGATGCAGTGGCGTCTTTTGCTGATGTT
GGATGGGTAGCCAAAGAAGAAGGAGAGTGTTCAGCAAGACTAAGGACAGAGGTCAGATCAAGGCCACCC
CTTCAGGATGACCTTCTTTTCTTTGAGAAGGCCCCAAGCAGACAGATTTCCTTACCAGACTTGTCTCAA
GAAGAGCCTCAGCTGAAGACCCCAGCGCTGGCAAATGAGGAAGCACTGCAGAAGATTTGCGCTCTCGAA
AATGAACTTGCTGCTCTCAGAGCTCAGATTGCCAAAATTGTGACCCAGCAGGAGCAGCAAAATCTCACT
GCAGGTGACTTAGATTCTACCACATTTGGTACCATACCACCACACCCTCCACCTCCCCCACCGCCCCTG
CCTCCCCCTGCACTGGGGCTCCACCAAAGTACATCTGCTGTTGATCTGATTAAAGAACGAAGAGAGAAA
AGAGCCAATGCTGGAAAGACTTTGGTTAAGAACAATCCAAAGAAACCTGAAATGCCAAATATGCTAGAG
ATCCTTAAAGAGATGAACAGTGTAAAACTTCGGTCAGTGAAGAGGTCAGAGCAAGATGTGAAGCCCAAG
CCAGTGGATGCTACTGACCCTGCTGCCCTCATAGCAGAGGCTCTGAAAAAGAAATTTGCTTATCGGTAT
CGAAGTGATAGCCAAGATGAAGTTGAAAAAGGAATTCCAAAGTCTGAATCAGAGGCCACCTCAGAGAGA
GTGTTGTTTGGGCCACACATGTTGAAGCCAACAGGAAAAATGAAGGCTTTAATTGAAAATGTATCAGAC
TCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001145838
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001145838.1
RefSeq Size 2509 bp
RefSeq ORF 903 bp
Locus ID 9650
UniProt ID Q15390
Cytogenetics 8q13.1
MW 33.2 kDa
Summary This gene encodes a mitochondrial protein that is characterized by a poly-proline rich region. A chicken homolog of this protein promotes mitochondrial fission and the mouse homolog protects cells from oxidative stress. A related pseudogene of this gene is found on chromosome X. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
Write Your Own Review
You're reviewing:MTFR1 (NM_001145838) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227926 MTFR1 (Myc-DDK-tagged)-Human mitochondrial fission regulator 1 (MTFR1), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$300.00
RC227926L3 Lenti ORF clone of Human mitochondrial fission regulator 1 (MTFR1), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC227926L4 Lenti ORF clone of Human mitochondrial fission regulator 1 (MTFR1), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged 10 ug
$600.00
RG227926 MTFR1 (tGFP-tagged) - Human mitochondrial fission regulator 1 (MTFR1), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.