NONO (NM_001145410) Human Untagged Clone

SKU
SC326468
NONO (untagged)-Human non-POU domain containing, octamer-binding (NONO), transcript variant 4, mRNA
$732.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NONO
Synonyms MRXS34; NMT55; NRB54; P54; P54NRB; PPP1R114
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326468 representing NM_001145410.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGAAACTATTTGAGAAATATGGAAAGGCAGGCGAAGTCTTCATTCATAAGGATAAAGGATTTGGC
TTTATCCGCTTGGAAACCCGAACCCTAGCGGAGATTGCCAAAGTGGAGCTGGACAATATGCCACTCCGT
GGAAAGCAGCTGCGTGTGCGCTTTGCCTGCCATAGTGCATCCCTTACAGTTCGAAACCTTCCTCAGTAT
GTGTCCAACGAACTGCTGGAAGAAGCCTTTTCTGTGTTTGGCCAGGTAGAGAGGGCTGTAGTCATTGTG
GATGATCGAGGAAGGCCCTCAGGAAAAGGCATTGTTGAGTTCTCAGGGAAGCCAGCTGCTCGGAAAGCT
CTGGACAGATGCAGTGAAGGCTCCTTCCTGCTAACCACATTTCCTCGTCCTGTGACTGTGGAGCCCATG
GACCAGTTAGATGATGAAGAGGGACTTCCAGAGAAGCTGGTTATAAAAAACCAGCAATTTCACAAGGAA
CGAGAGCAGCCACCCAGATTTGCACAGCCTGGCTCCTTTGAGTATGAATATGCCATGCGCTGGAAGGCA
CTCATTGAGATGGAGAAGCAGCAGCAGGACCAAGTGGACCGCAACATCAAGGAGGCTCGTGAGAAGCTG
GAGATGGAGATGGAAGCTGCACGCCATGAGCACCAGGTCATGCTAATGAGACAGGATTTGATGAGGCGC
CAAGAAGAACTTCGGAGGATGGAAGAGCTGCACAACCAAGAGGTGCAAAAACGAAAGCAACTGGAGCTC
AGGCAGGAGGAAGAGCGCAGGCGCCGTGAAGAAGAGATGCGGCGGCAGCAAGAAGAAATGATGCGGCGA
CAGCAGGAAGGATTCAAGGGAACCTTCCCTGATGCGAGAGAGCAGGAGATTCGGATGGGTCAGATGGCT
ATGGGAGGTGCTATGGGCATAAACAACAGAGGTGCCATGCCCCCTGCTCCTGTGCCAGCTGGTACCCCA
GCTCCTCCAGGACCTGCCACTATGATGCCGGATGGAACTTTGGGATTGACCCCACCAACAACTGAACGC
TTTGGTCAGGCTGCTACAATGGAAGGAATTGGGGCAATTGGTGGAACTCCTCCTGCATTCAACCGTGCA
GCTCCTGGAGCTGAATTTGCCCCAAACAAACGTCGCCGATACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001145410
Insert Size 1149 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001145410.1
RefSeq Size 2894 bp
RefSeq ORF 1149 bp
Locus ID 4841
UniProt ID Q15233
Cytogenetics Xq13.1
Protein Families Druggable Genome, Transcription Factors
MW 43.9 kDa
Summary This gene encodes an RNA-binding protein which plays various roles in the nucleus, including transcriptional regulation and RNA splicing. A rearrangement between this gene and the transcription factor E3 gene has been observed in papillary renal cell carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes exist on Chromosomes 2 and 16. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
Write Your Own Review
You're reviewing:NONO (NM_001145410) Human Untagged Clone
Your Rating
SKU Description Size Price
RC226591 NONO (Myc-DDK-tagged)-Human non-POU domain containing, octamer-binding (NONO), transcript variant 4 10 ug
$686.00
RC226591L1 Lenti-ORF clone of NONO (Myc-DDK-tagged)-Human non-POU domain containing, octamer-binding (NONO), transcript variant 4 10 ug
$986.00
RC226591L2 Lenti-ORF clone of NONO (mGFP-tagged)-Human non-POU domain containing, octamer-binding (NONO), transcript variant 4 10 ug
$986.00
RC226591L3 Lenti-ORF clone of NONO (Myc-DDK-tagged)-Human non-POU domain containing, octamer-binding (NONO), transcript variant 4 10 ug
$986.00
RC226591L4 Lenti-ORF clone of NONO (mGFP-tagged)-Human non-POU domain containing, octamer-binding (NONO), transcript variant 4 10 ug
$986.00
RG226591 NONO (tGFP-tagged) - Human non-POU domain containing, octamer-binding (NONO), transcript variant 4 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.