HOMER3 (NM_001145722) Human Untagged Clone

SKU
SC326465
HOMER3 (untagged)-Human homer homolog 3 (Drosophila) (HOMER3), transcript variant 1, mRNA
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HOMER3
Synonyms HOMER-3; VESL3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC326465 representing NM_001145722.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCACAGCCAGGGAGCAGCCAATCTTCAGCACACGGGCGCACGTGTTCCAAATTGACCCAGCCACC
AAGCGAAACTGGATCCCAGCGGGCAAGCACGCACTCACTGTCTCCTATTTCTACGATGCCACCCGCAAT
GTGTACCGCATCATCAGCATCGGAGGCGCCAAGGCCATCATCAACAGCACTGTCACTCCCAACATGACC
TTCACCAAAACTTCCCAGAAGTTCGGGCAGTGGGCCGACAGTCGCGCCAACACAGTCTACGGCCTGGGC
TTTGCCTCTGAACAGCATCTGACACAGTTTGCCGAGAAGTTCCAGGAAGTGAAGGAAGCAGCCAGGCTG
GCCAGGGAGAAATCTCAGGATGGCGGGGAGCTCACCAGTCCAGCCCTGGGGCTCGCCTCCCACCAGGTG
CCCCCGAGCCCTCTCGTCAGTGCCAACGGCCCCGGCGAGGAAAAACTGTTCCGCAGCCAGAGCGCTGAT
GCCCCCGGCCCCACAGAGCGCGAGCGGCTAAAGAAGATGTTGTCTGAGGGCTCCGTGGGCGAGGTACAG
TGGGAGGCCGAGTTTTTCGCACTGCAGGACAGCAACAACAAGCTGGCAGGCGCCCTGCGAGAGGCCAAC
GCCGCCGCAGCCCAGTGGAGGCAGCAGCTGGAGGCTCAGCGTGCAGAGGCCGAGCGGCTGCGGCAGCGG
GTGGCTGAGCTGGAGGCTCAGGCAGCTTCAGAGGTGACCCCCACCGGTGAGAAGGAGGGGCTGGGCCAG
GGCCAGTCGCTGGAACAGCTGGAAGCTCTGGTGCAAACCAAGGACCAGGAGATTCAGACCCTGAAGAGT
CAGACTGGGGGGCCCCGCGAGGCCCTGGAGGCTGCCGAGCGTGAGGAGACTCAGCAGAAGGTGCAGGAC
CTGGAGACCCGCAATGCGGAGTTGGAGCACCAGCTGCGGGCGATGGAGCGCAGCCTGGAGGAGGCACGG
GCAGAGCGGGAGCGGGCGCGGGCTGAGGTGGGCCGGGCAGCGCAGCTGCTGGACGTCAGCCTGTTTGAG
CTGAGTGAGCTGCGTGAGGGCCTGGCCCGCCTGGCTGAGGCTGCGCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001145722
Insert Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001145722.1
RefSeq Size 1859 bp
RefSeq ORF 1086 bp
Locus ID 9454
UniProt ID Q9NSC5
Cytogenetics 19p13.11
Protein Families Druggable Genome
MW 39.8 kDa
Summary This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
Transcript Variant: This variant (1), termed Homer-3A01, encodes the longest isoform (1). Both variants 1 and 2 encode the same protein (isoform 1).
Write Your Own Review
You're reviewing:HOMER3 (NM_001145722) Human Untagged Clone
Your Rating
SKU Description Size Price
RC226668 HOMER3 (Myc-DDK-tagged)-Human homer homolog 3 (Drosophila) (HOMER3), transcript variant 1 10 ug
$457.00
RC226668L3 Lenti ORF clone of Human homer homolog 3 (Drosophila) (HOMER3), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC226668L4 Lenti ORF clone of Human homer homolog 3 (Drosophila) (HOMER3), transcript variant 1, mGFP tagged 10 ug
$757.00
RG226668 HOMER3 (tGFP-tagged) - Human homer homolog 3 (Drosophila) (HOMER3), transcript variant 1 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.