DACH2 (NM_001139515) Human Untagged Clone

SKU
SC325917
DACH2 (untagged)-Human dachshund homolog 2 (Drosophila) (DACH2), transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DACH2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325917 representing NM_001139515.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAAGAAAACAAGCTGTTAACAGTTCAAGACCCGGCAGGCCCCCTAAGCGTTCTTTGGGAGTGTTG
CAGGAAAATGCCCGCCTTCTGACCCATGCAGTCCCAGGCCTCTTATCGCCAGGACTTATCACTCCGACA
GGTATAACAGCTGCAGCGATGGCTGAGGCGATGAAACTTCAGAAGATGAAGCTTATGGCTATGAACACT
CTTCAGGGAAATGGAAGCCAAAATGGGACCGAATCAGAGCCTGATGATCTTAATTCTAACACAGGTGGA
AGTGAATCCTCCTGGGATAAAGATAAGATGCAGTCTCCATTTGCTGCACCTGGACCCCAACATGGAATT
GCTCATGCAGCCCTAGCTGGCCAGCCAGGCATTGGGGGTGCTCCAACCCTCAATCCACTGCAGCAGAAC
CACCTGCTAACCAATAGACTGGATCTGCCATTTATGATGATGCCTCATCCCCTACTTCCAGTCAGCTTA
CCTCCTGCATCAGTTGCCATGGCAATGAATCAGATGAACCATCTCAATACTATTGCCAACATGGCTGCT
GCAGCACAGATTCACAGTCCACTCTCCAGAGCTGGTACCTCTGTTATAAAGGAGCGGATCCCAGAGAGT
CCTTCTCCTGCTCCTTCTCTAGAAGAGAATCATCGTCCTGGGAGCCAGACCTCTTCCCACACCAGCAGC
AGTGTGTCCAGCTCTCCCTCTCAGATGGATCATCATTTGGAAAGAATGGAAGAGGTACCAGTTCAAATT
CCAATAATGAAGTCACCCTTGGACAAGATACAGCTGACTCCTGGGCAGGCATTGCCCGCTGGATTCCCT
GGACCATTCATTTTTGCTGATAGTCTGTCCTCCGTGGAGACTCTGTTGACCAACATTCAGGGTCTGCTG
AAAGTTGCTTTGGATAATGCTCGCATCCAGGAGAAGCAGATTCAACAAGAAAAGAAGGAGCTGCGACTG
GAGCTCTATAGAGAGAGAGAAATTAGAGAAAACCTTGAAAGACAACTTGCAGTTGAGCTTCAAAGCAGA
ACTACTATGCAAAAGCGCCTGAAGAAGGAGAAAAAAACCAAGAGAAAATTGCAGGAAGCCTTGGAATTT
GAATCAAAGCGCCGGGAGCAAGTGGAGCAGGCACTTAAGCAAGCCACCACTAGTGACAGTGGCCTGAGG
ATGTTAAAAGATACTGGAATTCCAGATATTGAAATAGAAAACAATGGGACTCCTCATGATAGTGCTGCT
ATGCAAGGAGGTAACTATTACTGTTTAGAAATGGCACAACAGTTGTATTCAGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001139515
Insert Size 1299 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001139515.1
RefSeq Size 1803 bp
RefSeq ORF 1299 bp
Locus ID 117154
UniProt ID Q96NX9
Cytogenetics Xq21.2
Protein Families Transcription Factors
MW 47.2 kDa
Summary This gene is one of two genes which encode a protein similar to the Drosophila protein dachshund, a transcription factor involved in cell fate determination in the eye, limb and genital disc of the fly. The encoded protein contains two characteristic dachshund domains: an N-terminal domain responsible for DNA binding and a C-terminal domain responsible for protein-protein interactions. This gene is located on the X chromosome and is subject to inactivation by DNA methylation. The encoded protein may be involved in regulation of organogenesis and myogenesis, and may play a role in premature ovarian failure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (3) has an alternate 5' exon and uses a downstream start codon, compared to variant 1. The resulting isoform (c) has a shorter N-terminus, compared to isoform a.
Write Your Own Review
You're reviewing:DACH2 (NM_001139515) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227811 DACH2 (Myc-DDK-tagged)-Human dachshund homolog 2 (Drosophila) (DACH2), transcript variant 3 10 ug
$457.00
RC227811L3 Lenti ORF clone of Human dachshund homolog 2 (Drosophila) (DACH2), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC227811L4 Lenti ORF clone of Human dachshund homolog 2 (Drosophila) (DACH2), transcript variant 3, mGFP tagged 10 ug
$757.00
RG227811 DACH2 (tGFP-tagged) - Human dachshund homolog 2 (Drosophila) (DACH2), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.