Poliovirus Receptor (PVR) (NM_001135768) Human Untagged Clone

SKU
SC325837
PVR (untagged)-Human poliovirus receptor (PVR), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Poliovirus Receptor
Synonyms CD155; HVED; Necl-5; NECL5; PVS; TAGE4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325837 representing NM_001135768.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCGAGCCATGGCCGCCGCGTGGCCGCTGCTGCTGGTGGCGCTACTGGTGCTGTCCTGGCCACCC
CCAGGAACCGGGGACGTCGTCGTGCAGGCGCCCACCCAGGTGCCCGGCTTCTTGGGCGACTCCGTGACG
CTGCCCTGCTACCTACAGGTGCCCAACATGGAGGTGACGCATGTGTCACAGCTGACTTGGGCGCGGCAT
GGTGAATCTGGCAGCATGGCCGTCTTCCACCAAACGCAGGGCCCCAGCTATTCGGAGTCCAAACGGCTG
GAATTCGTGGCAGCCAGACTGGGCGCGGAGCTGCGGAATGCCTCGCTGAGGATGTTCGGGTTGCGCGTA
GAGGATGAAGGCAACTACACCTGCCTGTTCGTCACGTTCCCGCAGGGCAGCAGGAGCGTGGATATCTGG
CTCCGAGTGCTTGCCAAGCCCCAGAACACAGCTGAGGTTCAGAAGGTCCAGCTCACTGGAGAGCCAGTG
CCCATGGCCCGCTGCGTCTCCACAGGGGGTCGCCCGCCAGCCCAAATCACCTGGCACTCAGACCTGGGC
GGGATGCCCAATACGAGCCAGGTGCCAGGGTTCCTGTCTGGCACAGTCACTGTCACCAGCCTCTGGATA
TTGGTGCCCTCAAGCCAGGTGGACGGCAAGAATGTGACCTGCAAGGTGGAGCACGAGAGCTTTGAGAAG
CCTCAGCTGCTGACTGTGAACCTCACCGTGTACTACCCCCCAGAGGTATCCATCTCTGGCTATGATAAC
AACTGGTACCTTGGCCAGAATGAGGCCACCCTGACCTGCGATGCTCGCAGCAACCCAGAGCCCACAGGC
TATAATTGGAGCACGACCATGGGTCCCCTGCCACCCTTTGCTGTGGCCCAGGGCGCCCAGCTCCTGATC
CGTCCTGTGGACAAACCAATCAACACAACTTTAATCTGCAACGTCACCAATGCCCTAGGAGCTCGCCAG
GCAGAACTGACCGTCCAGGTCAAAGAGGGACCTCCCAGTGAGCACTCAGGTACAGAGCATGCCAGCGCC
TCAGCTAATGGGCATGTCTCCTATTCAGCTGTGAGCAGAGAGAACAGCTCTTCCCAGGATCCACAGACA
GAGGGCACAAGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001135768
Insert Size 1119 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001135768.2
RefSeq Size 5768 bp
RefSeq ORF 1119 bp
Locus ID 5817
UniProt ID P15151
Cytogenetics 19q13.31
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 40.1 kDa
Summary The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (beta) lacks an internal segment including the putative transmembrane domain, compared to isoform alpha, resulting in its secretion into serum and cerebrospinal fluid. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Poliovirus Receptor (PVR) (NM_001135768) Human Untagged Clone
Your Rating
SKU Description Size Price
RC226991 PVR (Myc-DDK-tagged)-Human poliovirus receptor (PVR), transcript variant 2 10 ug
$457.00
RC226991L3 Lenti ORF clone of Human poliovirus receptor (PVR), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC226991L4 Lenti ORF clone of Human poliovirus receptor (PVR), transcript variant 2, mGFP tagged 10 ug
$757.00
RG226991 PVR (tGFP-tagged) - Human poliovirus receptor (PVR), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.