GKAP1 (NM_001135953) Human Untagged Clone

SKU
SC325762
GKAP1 (untagged)-Human G kinase anchoring protein 1 (GKAP1), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GKAP1
Synonyms FKSG21; GKAP42
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325762 representing NM_001135953.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCTCAGCAGTACTTAGTTCTGTTCCCACCACCGCTTCTCGTTTTGCCCTGTTACAAGTGGATAGT
GGCAGTGGCTCTGATTCTGAACCTGGAAAAGGTAAAGGTCGAAATACTGGAAAGTCTCAAACTTTAGGA
AGCAAGTCAACTACAAATGAGAAAAAAAGAGAGAAAAGAAGAAAAAAGAAGGAACAGCAACAGAGTGAA
GCAAATGAGCTCAGGAATCTTGCTTTTAAGAAAATTCCCCAGAAATCCTCCCATGCTGTTTGTAACGCT
CAACATGATCTTCCATTGTCAAACCCAGTACAGAAGGATTCACGAGAAGAAAATTGGCAAGAGTGGAGA
CAAAGAGATGAGCAGCTGACATCTGAAATGTTTGAAGCAGATCTTGAGAAGGCATTGTTACTAAGTAAA
CTAGAATATGAAGAGCACAAAAAGGAGTATGAAGATGCTGAAAATACTTCAACTCAGTCCAAAGTTATG
AATAAAAAAGATAAAAGAAAGAATCATCAGGGAAAAGACAGACCTCTCACAGTATCACTAAAAGATTTT
CATTCGGAAGATCACATTAGTAAAAAGACTGAGGAAGTGGTTCTGAAAGATGGAAGAATTGAAAGACTA
AAGTTAGAGCTTGAAAGGAAAGATGCTGAAATCCAGAAGCTGAAAAATGTAATCACTCAATGGGAGGCA
AAGTATAAGGAAGTAAAGGCAAGAAATGCACAATTATTGAAAATGCTTCAGGAAGGTGAAATGAAAGAT
AAGGCAGAAATACTTCTGCAAGTTGATGAATCACAAAGTATCAAGAATGAGCTCACTATTCAGGTGACT
TCACTTCATGCTGCATTAGAACAAGAAAGATCTAAAGTGAAAGTATTACAAGCAGAGTTAGCCAAATAC
CAGGGTGGCAGAAAAGGGAAAAGAAACTCTGAATCCGACCAGTGTAGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001135953
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001135953.1
RefSeq Size 1738 bp
RefSeq ORF 948 bp
Locus ID 80318
UniProt ID Q5VSY0
Cytogenetics 9q21.32
Protein Families Druggable Genome
MW 36.1 kDa
Summary This gene encodes a protein that is highly similar to the mouse cGMP-dependent protein kinase anchoring protein 42kDa. The mouse protein has been found to localize with the Golgi and recruit cGMP-dependent protein kinase I alpha to the Golgi in mouse testes. It is thought to play a role in germ cell development. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b) compared to isoform a.
Write Your Own Review
You're reviewing:GKAP1 (NM_001135953) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227915 GKAP1 (Myc-DDK-tagged)-Human G kinase anchoring protein 1 (GKAP1), transcript variant 2 10 ug
$300.00
RC227915L3 Lenti ORF clone of Human G kinase anchoring protein 1 (GKAP1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC227915L4 Lenti ORF clone of Human G kinase anchoring protein 1 (GKAP1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG227915 GKAP1 (tGFP-tagged) - Human G kinase anchoring protein 1 (GKAP1), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.