OSR2 (NM_001142462) Human Untagged Clone

SKU
SC325755
OSR2 (untagged)-Human odd-skipped related 2 (Drosophila) (OSR2), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol OSR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325755 representing NM_001142462.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAGCAAGGCTCTGCCAGCGCCCATCCCGCTCCACCCGTCGCTGCAGCTCACCAATTACTCCTTC
CTGCAGGCCGTGAACACCTTCCCGGCCACGGTGGACCACCTGCAGGGCCTGTACGGTCTCAGCGCGGTA
CAGACCATGCACATGAACCACTGGACGCTGGGGTATCCCAATGTGCACGAGATCACCCGCTCCACCATC
ACGGAGATGGCGGCGGCGCAGGGCCTCGTGGACGCGCGCTTCCCCTTCCCGGCCCTGCCTTTTACCACC
CACCTATTCCACCCCAAGCAGGGGGCCATTGCCCACGTCCTCCCAGCCCTGCACAAGGACCGGCCCCGT
TTTGACTTTGCCAATTTGGCGGTGGCTGCCACGCAAGAGGATCCGCCTAAGATGGGAGACCTGAGCAAG
CTGAGCCCAGGACTGGGTAGCCCCATCTCGGGCCTCAGTAAATTGACTCCGGACAGAAAGCCCTCTCGA
GGAAGGTTGCCCTCCAAAACGAAAAAAGAGTTTATCTGCAAGTTTTGCGGCAGACACTTTACCAAATCC
TACAATTTGCTCATCCATGAGAGGACCCACACGGACGAGAGGCCGTACACGTGTGACATCTGCCACAAG
GCCTTCCGGAGGCAAGATCACCTGCGGGATCACAGATACATCCATTCCAAAGAAAAACCCTTCAAATGT
CAGGAGTGTGGGAAAGGATTTTGTCAGTCTAGAACTCTAGCAGTTCACAAAACTTTACACATGCAGGAA
TCTCCACACAAATGTCCCACATGTGGAAGAACCTTTAATCAGAGAAGTAATCTGAAAACTCACCTTCTC
ACCCATACAGACATCAAGCCCTACAGCTGCGAGCAGTGCGGCAAAGTGTTCAGGCGAAACTGTGATCTG
CGGCGGCACAGCCTGACTCACACCCCGCGGCAGGACTTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001142462
Insert Size 939 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001142462.2
RefSeq Size 1877 bp
RefSeq ORF 939 bp
Locus ID 116039
UniProt ID Q8N2R0
Cytogenetics 8q22.2
MW 35.5 kDa
Summary OSR2 is a mammalian homolog of the Drosophila odd-skipped family of transcription factors (Lan et al., 2004 [PubMed 15175245]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) differs in the 5' UTR and 5' coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (a) with a shorter N-terminus, compared to isoform c.
Write Your Own Review
You're reviewing:OSR2 (NM_001142462) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227535 OSR2 (Myc-DDK-tagged)-Human odd-skipped related 2 (Drosophila) (OSR2), transcript variant 1 10 ug
$450.00
RC227535L1 Lenti ORF clone of Human odd-skipped related 2 (Drosophila) (OSR2), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC227535L2 Lenti ORF clone of Human odd-skipped related 2 (Drosophila) (OSR2), transcript variant 1, mGFP tagged 10 ug
$750.00
RC227535L3 Lenti ORF clone of Human odd-skipped related 2 (Drosophila) (OSR2), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC227535L4 Lenti ORF clone of Human odd-skipped related 2 (Drosophila) (OSR2), transcript variant 1, mGFP tagged 10 ug
$750.00
RG227535 OSR2 (tGFP-tagged) - Human odd-skipped related 2 (Drosophila) (OSR2), transcript variant 1 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.