NR2F2 (NM_001145155) Human Untagged Clone

SKU
SC325706
NR2F2 (untagged)-Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2
$480.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NR2F2
Synonyms ARP-1; ARP1; CHTD4; COUPTF2; COUPTFB; COUPTFII; NF-E3; SRXX5; SVP40; TFCOUP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325706 representing NM_001145155.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAAGCGGTTTGGGACCTTGAACAAGGCAAATATGGTTTTGCGGTGCAGAGGGGCAGGATGCCGCCG
ACCCAGCCGACCCACGGGCAGTTCGCGCTGACCAACGGGGATCCCCTCAACTGCCACTCGTACCTGTCC
GGATATATTTCCCTGCTGTTGCGCGCGGAGCCCTATCCCACGTCGCGCTTCGGCAGCCAATGCATGCAG
CCCAACAACATCATGGGTATCGAGAACATTTGCGAACTGGCCGCGAGGATGCTCTTCAGCGCCGTCGAG
TGGGCCCGGAACATCCCCTTCTTCCCCGACCTGCAGATCACGGACCAGGTGGCCCTGCTTCGCCTCACC
TGGAGCGAGCTGTTTGTGTTGAATGCGGCGCAGTGCTCCATGCCCCTCCACGTCGCCCCGCTCCTGGCC
GCCGCCGGCCTGCATGCTTCGCCCATGTCCGCCGACCGGGTGGTCGCCTTTATGGACCACATACGGATC
TTCCAAGAGCAAGTGGAGAAGCTCAAGGCGCTGCACGTTGACTCAGCCGAGTACAGCTGCCTCAAGGCC
ATAGTCCTGTTCACCTCAGATGCCTGTGGTCTCTCTGATGTAGCCCATGTGGAAAGCTTGCAGGAAAAG
TCTCAGTGTGCTTTGGAAGAATACGTTAGGAGCCAGTACCCCAACCAGCCGACGAGATTCGGAAAGCTT
TTGCTTCGCCTCCCTTCCCTCCGCACCGTCTCCTCCTCAGTCATAGAGCAATTGTTTTTCGTCCGTTTG
GTAGGTAAAACCCCCATCGAAACCCTCATCCGGGATATGTTACTGTCCGGCAGCAGTTTTAACTGGCCG
TATATGGCAATTCAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001145155
Insert Size 846 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001145155.1
RefSeq Size 3869 bp
RefSeq ORF 846 bp
Locus ID 7026
UniProt ID P24468
Cytogenetics 15q26.2
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
MW 31.5 kDa
Summary This gene encodes a member of the steroid thyroid hormone superfamily of nuclear receptors. The encoded protein is a ligand inducible transcription factor that is involved in the regulation of many different genes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:NR2F2 (NM_001145155) Human Untagged Clone
Your Rating
SKU Description Size Price
RC226609 NR2F2 (Myc-DDK-tagged)-Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2 10 ug
$450.00
RC226609L1 Lenti ORF clone of Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2, Myc-DDK-tagged 10 ug
$750.00
RC226609L2 Lenti ORF clone of Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2, mGFP tagged 10 ug
$750.00
RC226609L3 Lenti ORF clone of Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2, Myc-DDK-tagged 10 ug
$750.00
RC226609L4 Lenti ORF clone of Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2, mGFP tagged 10 ug
$750.00
RG226609 NR2F2 (tGFP-tagged) - Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.