NECAP2 (NM_001145277) Human Untagged Clone

SKU
SC325692
NECAP2 (untagged)-Human NECAP endocytosis associated 2 (NECAP2), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NECAP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325692 representing NM_001145277.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGAGAGCGGGTACGAGTCGGTGCTCTGTGTCAAGCCTGACGTCCACGTCTACCGCATCCCTCCG
CGGGCTACCAACCGTGGCTACAGGGCTGCGGAGTGGCAGCTGGACCAGCCATCATGGAGTGGCCGGCTG
AGGATCACTGCAAAGGGACAGATGGCCTACATCAAGCTGGAGGACAGGACGTCAGGGGAGCTCTTTGCT
CAGGCCCCGGTGGATCAGTTTCCTGGCACAGCTGTGGAGAGTGTGACGGATTCCAGCAGGTACTTCGTG
ATCCGCATCGAAGATGGAAATGGGCGACGGGCGTTTATTGGAATTGGCTTCGGGGACCGAGGTGATGCC
TTTGACTTCAATGTTGCATTGCAGGACCATTTCAAGTGGGTGAAACAGCAGTGTGAATTTGCAAAACAA
GCCCAGAACCCAGACCAAGGCCCTAAACTGGACCTGGGCTTCAAGGAGGGCCAGACCATCAAGCTCAAC
ATCGCAAACATGAAGAAGAAGGAAGGAGCAGCTGGGAATCCCCGAGTCCGGCCTGCCAGCACAGGAGGG
CTGAGCCTGCTTCCCCCTCCCCCAGGGGGGAAAACCTCCACCCTGATCCCTCCCCCTGGGGAGCAGTTG
GCTGTGGGGGGATCCCTCGTCCAGCCAGCAGTTGCTCCCAGTTCAGATCAACTTCCAGCCAGACCCAGC
CAGGCACAGGCTGGGTCCAGTTCTGACCTGAGCACGGTTTTTCCTCATGTGACTTCTGGGAAGGCGCTC
CCTCATCTGGGCCAAAGGAAGGAGGACGAAGCCCTCCTCAGCTGGCCTGTGTTTGGGGCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001145277
Insert Size 822 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001145277.1
RefSeq Size 2016 bp
RefSeq ORF 822 bp
Locus ID 55707
UniProt ID Q9NVZ3
Cytogenetics 1p36.13
MW 29.5 kDa
Summary This gene likely encodes a member of the adaptin-ear-binding coat-associated protein family. Studies of a similar protein in rat suggest a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region compared to variant 1 that causes a frameshift. The resulting protein (isoform 2) has a distinct C-terminus compared to isoform 1.
Write Your Own Review
You're reviewing:NECAP2 (NM_001145277) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227659 NECAP2 (Myc-DDK-tagged)-Human NECAP endocytosis associated 2 (NECAP2), transcript variant 2 10 ug
$300.00
RC227659L3 Lenti ORF clone of Human NECAP endocytosis associated 2 (NECAP2), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC227659L4 Lenti ORF clone of Human NECAP endocytosis associated 2 (NECAP2), transcript variant 2, mGFP tagged 10 ug
$600.00
RG227659 NECAP2 (tGFP-tagged) - Human NECAP endocytosis associated 2 (NECAP2), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.