CHAC1 (NM_001142776) Human Untagged Clone

SKU
SC325621
CHAC1 (untagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CHAC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325621 representing NM_001142776.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGGGCGCTCAGCTGGAGCTACCGAGCGGTGCCAGGCCAGGTGTGTGCGTCCGTCGGTCTTTCCGT
GCCCACGCCGGAGACCAGCCCCGGAGGCCGCCTGGGCCTATCCCTGTGCCAGGCACCATGAAGCAGGAG
TCTGCAGCCCCGAACACCCCGCCCACCTCGCAGTCCCCTACGCCGTCCGCTCAGTTCCCCCGAAACGAC
GGCGACCCTCAAGCGCTGTGGATTTTCGGGTACGGCTCCCTGGTGTGGAGGCCCGACTTCGCCTACAGC
GACAGCCGTGTGGGCTTCGTGCGCGGCTACAGCCGCCGTTTCTGGCAGGGAGACACCTTCCATCGGGGC
AGCGACAAGATGCCTGGCCGTGTGGTGACGCTCCTTGAAGATCATGAGGGCTGCACTTGGGGCGTGGCA
TACCAAGTGCAAGGGGAGCAGAACCCTGGTTACCTGGGCCCTGCGCCTGAAGAGGCCATTGCCACGCAG
ATCCTGGCCTGCCGGGGCTTCTCCGGCCACAACCTTGAATACTTGCTGCGTCTGGCAGACTTCATGCAG
CTCTGTGGGCCTCAGGCGCAGGACGAGCACCTGGCAGCCATCGTGGACGCTGTGGGCACCATGTTGCCC
TGCTTCTGCCCCACCGAGCAGGCTCTGGCGCTGGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001142776
Insert Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001142776.1
RefSeq Size 1443 bp
RefSeq ORF 660 bp
Locus ID 79094
Cytogenetics 15q15.1
MW 23.8 kDa
Summary This gene encodes a member of the gamma-glutamylcyclotransferase family of proteins. The encoded protein has been shown to promote neuronal differentiation by deglycination of the Notch receptor, which prevents receptor maturation and inhibits Notch signaling. This protein may also play a role in the unfolded protein response, and in regulation of glutathione levels and oxidative balance in the cell. Elevated expression of this gene may indicate increased risk of cancer recurrence among breast and ovarian cancer patients. [provided by RefSeq, Sep 2016]
Transcript Variant: This variant (2) lacks an alternate in-frame segment, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. CCDS Note: The coding region has been updated to trim the N-terminus to one that is more supported by available transcript data, CAGE data and conservation data.
Write Your Own Review
You're reviewing:CHAC1 (NM_001142776) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227708 CHAC1 (Myc-DDK-tagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 2 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC227708L1 Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC227708L2 Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 2, mGFP tagged 10 ug
$600.00
RC227708L3 Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC227708L4 Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG227708 CHAC1 (tGFP-tagged) - Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.