FXYD3 (NM_001136012) Human Untagged Clone

SKU
SC325470
FXYD3 (untagged)-Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 8
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FXYD3
Synonyms MAT8; PLML
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325470 representing NM_001136012.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGAAGGTGACCCTGGGCCTGCTTGTGTTCCTGGCAGGCTTTCCTGTCCTGGACGCCAATGACCTA
GAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAGGTTGGCGGGCTCATCTGCGCTGGG
GTTCTGTGCGCCATGGGCATCATCATCGTCATGAGTGAGTGGAGGAGCTCGGGGGAGCAGGCGGGCCGG
GGCTGGGGCTCCCCTCCCCTGACCACTCAGCTCTCCCCAACAGGTGCAAAATGCAAATGCAAGTTTGGC
CAGAAGTCCGGTCACCATCCAGGGGAGACTCCACCTCTCATCACCCCAGGCTCAGCCCAAAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001136012
Insert Size 342 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001136012.1
RefSeq Size 1460 bp
RefSeq ORF 342 bp
Locus ID 5349
UniProt ID Q14802
Cytogenetics 19q13.12
Protein Families Ion Channels: Other, Transmembrane
MW 12 kDa
Summary This gene belongs to a small family of FXYD-domain containing regulators of Na+/K+ ATPases which share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD, and containing 7 invariant and 6 highly conserved amino acids. This gene encodes a cell membrane protein that may regulate the function of ion-pumps and ion-channels. This gene may also play a role in tumor progression. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
Transcript Variant: This variant (8) has multiple differences in the coding region, compared to variant 3. These differences result in translation initiation from a downstream in-frame ATG and an isoform (2) with a shorter N-terminus and longer C-terminus when compared to isoform 3. Variants 2 and 8 encode the same isoform (2).
Write Your Own Review
You're reviewing:FXYD3 (NM_001136012) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227269 FXYD3 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 8 10 ug
$150.00
RC227269L3 Lenti ORF clone of Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 8, Myc-DDK-tagged 10 ug
$450.00
RC227269L4 Lenti ORF clone of Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 8, mGFP tagged 10 ug
$450.00
RG227269 FXYD3 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 3 (FXYD3), transcript variant 8 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.