NFKBIL1 (NM_001144961) Human Untagged Clone

SKU
SC325005
NFKBIL1 (untagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 (NFKBIL1), transcript variant 2
$503.00
5 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NFKBIL1
Synonyms IKBL; NFKBIL
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001144961, the custom clone sequence may differ by one or more nucleotides
ATGAGTAACCCCTCCCCCCAGGTTCCAGAGGAAGAAGCCTCCACATCTGTCTGCCGGCCC
AAGAGTTCCATGGCCTCCACTTCCCGCCGCCAACGCCGAGAACGTCGCTTTCGTCGTTAC
TTGTCTGCAGGACGGCTGGTCCGGGCCCAGGCCCTCCTCCAGCGACACCCAGGCCTCGAT
GTAGATGCTGGGCAGCCCCCACCACTGCACCGGGCCTGTGCCCGCCACGATGCCCCTGCC
CTGTGCCTGCTGCTTCGGCTCGGGGCTGACCCTGCCCACCAGGACCGCCATGGGGACACG
GCACTGCATGCTGCTGCCCGCCAGGGCCCAGATGCCTACACCGATTTCTTCCTCCCGCTG
CTAAGCCGCTGTCCCTCCGCCATGGGAATAAAGAATAAGGATGGGGAGACCCCTGGCCAA
ATTTTGGGCTGGGGACCCCCCTGGGATTCTGCTGAAGAGGAGGAAGAAGATGATGCCTCC
AAGGAGCGGGAATGGAGACAGAAGCTCCAGGGTGATGCCTCCCATGAAACCCAGGAACCT
GAGTCCTTCTCAGCCTGGTCAGATCGCCTGGCCCGGGAACATGCCCAGAAGTGCCAGCAG
CAGCAGCGAGAAGCAGAGGGATCCCGTCGACCCCCACGTGCTGAGGGCTCCAGCCAGAGC
TGGCGACAGCAGGAGGAGGAGCAGCGGCTCTTCAGGGAGCGAGCCCGGGCCAAGGAGGAA
GAGCTGCGTGAGAGCCGAGCCAGGAGGGCGCAGGAGGCTCTAGGGGACCGAGAACCCAAG
CCAACCAGGGCCGGGCCCAGGGAAGAGCACCCCAGAGGAGCGGGGAGGGGCAGCCTCTGG
CGATTTGGTGATGTGCCCTGGCCCTGCCCTGGGGGAGGGGACCCAGAGGCCATGGCTGCA
GCCCTGGTGGCCAGGGGCCCCCCTTTGGAGGAACAGGGGGCTCTGAGGAGGTACTTGAGG
GTCCAGCAGGTCCGCTGGCACCCTGACCGCTTCCTGCAGCGATTCCGAAGCCAGATTGAG
ACCTGGGAGCTGGGCCGTGTGATGGGAGCAGTGACAGCCCTTTCTCAGGCCCTGAATCGC
CATGCAGAGGCCCTCAAG
Restriction Sites Please inquire
ACCN NM_001144961
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001144961.1, NP_001138433.1
RefSeq Size 1465 bp
RefSeq ORF 1101 bp
Locus ID 4795
UniProt ID Q9UBC1
Cytogenetics 6p21.33
Protein Families Transcription Factors
Summary This gene encodes a divergent member of the I-kappa-B family of proteins. Its function has not been determined. The gene lies within the major histocompatibility complex (MHC) class I region on chromosome 6. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 3' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
Write Your Own Review
You're reviewing:NFKBIL1 (NM_001144961) Human Untagged Clone
Your Rating
SKU Description Size Price
RC226589 NFKBIL1 (Myc-DDK-tagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 (NFKBIL1), transcript variant 2 10 ug
$503.00
RC226589L3 Lenti-ORF clone of NFKBIL1 (Myc-DDK-tagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 (NFKBIL1), transcript variant 2 10 ug
$803.00
RC226589L4 Lenti-ORF clone of NFKBIL1 (mGFP-tagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 (NFKBIL1), transcript variant 2 10 ug
$803.00
RG226589 NFKBIL1 (tGFP-tagged) - Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 (NFKBIL1), transcript variant 2 10 ug
$703.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.