ALS2CR1 (NIF3L1) (NM_001142355) Human Untagged Clone

SKU
SC324978
NIF3L1 (untagged)-Human NIF3 NGG1 interacting factor 3-like 1 (S. pombe) (NIF3L1), transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ALS2CR1
Synonyms ALS2CR1; CALS-7; MDS015
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324978 representing NM_001142355.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATTTGAAGGCTCTCCTTTCTTCCTTGAATGACTTTGCATCCCTCTCGTTTGCTGAGAGTTGGGAC
AATGTTGGATTACTGGTGGAACCAAGCCCACCACATACTGTAAATACACTCTTCCTGACCAATGACCTG
ACTGAGGAAGTGATGGAGGAGGTGCTGCAAAAGAAGGCAGACCTCATTCTCTCCTACCATCCGCCTATC
TTCCGACCCATGAAGCGCATAACCTGGAACACATGGAAGGAGCGCCTGGTGATCCGGGCTCTGGAGAAC
AGAGTCGGTATCTACTCTCCTCATACAGCCTATGATGCTGCGCCCCAGGGCGTCAACAACTGGTTGGCT
AAAGGGCTTGGAGCTTGTACCTCCAGGCCCATACATCCTTCCAAAGCTCCCAACTACCCTACAGAGGGA
AACCACCGAGTAGAATTCAACGTTAACTACACCCAAGACCTGGACAAAGTCATGTCTGCAGTGAAAGGA
ATTGACGGTGTTTCTGTCACTTCTTTTTCTGCTAGGACTGGTAATGAGGAACAAACACGGATTAATCTG
AATTGTACTCAGAAGGCTTTGATGCAGGTGGTAGATTTTCTTTCCCGGAACAAACAACTTTATCAGAAG
ACGGAAATTCTGTCACTGGAGAAGCCTTTGCTTCTACATACTGGAATGGGACGGTTATGCACACTGGAT
GAATCTGTCTCCCTGGCAACCATGATTGATCGAATAAAAAGACACCTAAAACTATCTCATATTCGCTTA
GCCCTTGGGGTGGGGAGAACCTTAGAGTCTCAAGTCAAAGTCGTGGCCCTGTGTGCTGGTTCTGGGAGC
AGCGTTCTGCAGGGTGTTGAGGCTGACCTTTACCTCACAGGTGAGATGTCCCATCATGATACTTTGGAT
GCTGCTTCCCAAGGAATAAATGTCATCCTCTGTGAACACAGCAACACTGAACGAGGCTTTCTTTCTGAC
CTTCGAGATATGCTGGATTCTCACTTGGAGAATAAGATAAATATTATCCTATCAGAGACTGACAGGGAC
CCTCTTCAGGTGGTATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001142355
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001142355.1
RefSeq Size 1446 bp
RefSeq ORF 1053 bp
Locus ID 60491
UniProt ID Q9GZT8
Cytogenetics 2q33.1
MW 39 kDa
Summary May function as a transcriptional corepressor through its interaction with COPS2, negatively regulating the expression of genes involved in neuronal differentiation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and uses a downstream in-frame translation initiation codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, compared to isoform 1. Both variants 2 and 3 encode the same isoform.
Write Your Own Review
You're reviewing:ALS2CR1 (NIF3L1) (NM_001142355) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227825 NIF3L1 (Myc-DDK-tagged)-Human NIF3 NGG1 interacting factor 3-like 1 (S. pombe) (NIF3L1), transcript variant 3 10 ug
$457.00
RC227825L3 Lenti ORF clone of Human NIF3 NGG1 interacting factor 3-like 1 (S. pombe) (NIF3L1), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC227825L4 Lenti ORF clone of Human NIF3 NGG1 interacting factor 3-like 1 (S. pombe) (NIF3L1), transcript variant 3, mGFP tagged 10 ug
$757.00
RG227825 NIF3L1 (tGFP-tagged) - Human NIF3 NGG1 interacting factor 3-like 1 (S. pombe) (NIF3L1), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.