MAP3K12 binding inhibitory protein 1 (MBIP) (NM_001144891) Human Untagged Clone

SKU
SC324970
MBIP (untagged)-Human MAP3K12 binding inhibitory protein 1 (MBIP), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAP3K12 binding inhibitory protein 1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324970 representing NM_001144891.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCTGCCACGGAGCTTAATCGCCCGAGCAGCGGTGACAGGAACCTGGAGCGAAGATGCAGACCC
AACCTCTCCCGAGAGGTGCTCTACGAAATCTTTCGCTCCCTACACACCCTGGTTGGACAGCTTGACCTC
AGAGATGATGTGGTGAAAATTACAATCGATTGGAACAAGCTCCAGAGCCTCTCGGCATTCCAGCCTGCA
TTGCTCTTTAGTGCACTTGAACAACACATTTTATATTTACAGCCTTTTTTAGCAAAACTTCAGTCTCCG
ATTAAAGAGGAGAATACAACTGCTGTTGAAGAGATAGGAAGAACAGAAATGGGGAACAAAAATGAAGTA
AATGACAAATTTTCCATTGGCGACCTACAAGAGGAAGAAAAGCACAAAGAAAGTGATTTAAGAGATGTG
AAAAAGACACAGATCCATTTTGATCCAGAAGTAGTTCAGATAAAGGCTGGAAAAGCAGAAATTGACAGA
CGAATATCTGCATTTATTGAAAGAAAGCAAGCTGAAATCAATGAAAACAACGTCAGGGAATTTTGCAAT
GTTATTGATTGTAATCAAGAAAATAGTTGTGCAAGAACTGATGCGATTTTTACCCCTTACCCCGGATTT
AAAAGTCACGTAAAAGTTTCTAGAGTTGTGAATACATACGGACCACAGACTAGACCTGAAGGAATTCCA
GGGTCAGGTCATAAACCTAACAGCATGCTTCGAGACTGTGGTAATCAGGCTGTAGAAGAACGACTACAA
AATATTGAGGCCCACTTGCGGTTACAGACAGGTGGTCCAGTGCCAAGAGACATTTATCAGAGAATTAAA
AAACTTGAGGATAAAATCCTTGAATTGGAAGGCATCTCTCCTGAATATTTTCAGTCTGTAAGCTTTTCT
GGAAAAAGAAGAAAAGTTCAACCACCTCAAAACTATTCACTGGCTGAACTTGATGAGAAAATTAGTGCC
CTCAAACAAGCCCTCCTCAGAAAATCAAGAGAAGCAGAATCCATGGCAACCCACCACCTTCCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001144891
Insert Size 1032 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001144891.1
RefSeq Size 1658 bp
RefSeq ORF 1032 bp
Locus ID 51562
UniProt ID Q9NS73
Cytogenetics 14q13.3
MW 39.2 kDa
Summary Inhibits the MAP3K12 activity to induce the activation of the JNK/SAPK pathway. Component of the ATAC complex, a complex with histone acetyltransferase activity on histones H3 and H4.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. The encoded protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1.
Write Your Own Review
You're reviewing:MAP3K12 binding inhibitory protein 1 (MBIP) (NM_001144891) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227248 MBIP (Myc-DDK-tagged)-Human MAP3K12 binding inhibitory protein 1 (MBIP), transcript variant 2 10 ug
$457.00
RC227248L3 Lenti ORF clone of Human MAP3K12 binding inhibitory protein 1 (MBIP), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC227248L4 Lenti ORF clone of Human MAP3K12 binding inhibitory protein 1 (MBIP), transcript variant 2, mGFP tagged 10 ug
$757.00
RG227248 MBIP (tGFP-tagged) - Human MAP3K12 binding inhibitory protein 1 (MBIP), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.