RG9MTD2 (TRMT10A) (NM_001134665) Human Untagged Clone

SKU
SC324962
TRMT10A (untagged)-Human RNA (guanine-9-) methyltransferase domain containing 2 (RG9MTD2), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RG9MTD2
Synonyms HEL-S-88; MSSGM; MSSGM1; RG9MTD2; TRM10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC324962 representing NM_001134665.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCATCTGAAATGTTGCCAGCATTTATTGAAACTTCTAATGTTGACAAAAAGCAAGGCATAAATGAA
GATCAAGAGGAGAGCCAGAAGCCAAGATTAGGTGAAGGGTGTGAACCAATATCTAAACGACAAATGAAA
AAACTAATAAAACAGAAACAATGGGAAGAGCAACGGGAACTCCGCAAACAAAAGCGAAAAGAAAAACGC
AAGAGGAAAAAATTAGAGCGACAATGTCAAATGGAACCAAACTCAGATGGACATGACAGAAAACGTGTT
CGAAGAGATGTTGTTCATAGCACCCTTCGCCTTATTATTGACTGTAGTTTTGATCACTTGATGGTATTA
AAGGACATTAAGAAACTTCATAAGCAGATTCAACGATGTTACGCAGAAAACCGACGGGCACTGCATCCT
GTGCAGTTTTACTTGACAAGCCACGGAGGCCAGCTGAAAAAGAACATGGATGAAAATGACAAAGGATGG
GTCAACTGGAAGGATATCCATATCAAACCAGAGCACTATAGTGAACTCATAAAGAAAGAAGACCTGATT
TACCTTACGTCAGATTCACCTAATATACTGAAGGAATTAGATGAATCAAAGGCCTATGTGATTGGAGGA
TTAGTAGATCACAACCATCACAAGGGACTCACATATAAACAAGCGTCAGATTATGGAATCAATCATGCA
CAGCTCCCACTTGGAAATTTTGTGAAGATGAATAGTCGAAAAGTTTTGGCAGTTAATCATGTGTTTGAA
ATTATTCTGGAATACCTGGAAACAAGAGACTGGCAAGAAGCATTTTTTACTATCTTGCCCCAACGGAAA
GGAGCTGTTCCCACAGACAAAGCCTGTGAAAGTGCTTCTCATGACAATCAGTCTGTCAGGATGGAGGAA
GGTGGATCGGACAGTGATTCCAGTGAGGAGGAATATAGCAGAAATGAACTAGATTCACCACATGAAGAA
AAGCAGGATAAGGAAAATCACACTGAATCTACAGTGAACTCTCTGCCACACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001134665
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001134665.2
RefSeq Size 3577 bp
RefSeq ORF 1020 bp
Locus ID 93587
UniProt ID Q8TBZ6
Cytogenetics 4q23
MW 39.7 kDa
Summary This gene encodes a protein that belongs to the tRNA (Guanine-1)-methyltransferase family. A similar gene in yeast modifies several different tRNA species. Mutations in this gene are associated with microcephaly, short stature, and impaired glucose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All three variants encode the same protein.
Write Your Own Review
You're reviewing:RG9MTD2 (TRMT10A) (NM_001134665) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225499 TRMT10A (Myc-DDK-tagged)-Human RNA (guanine-9-) methyltransferase domain containing 2 (RG9MTD2), transcript variant 2 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC225499L3 Lenti ORF clone of Human RNA (guanine-9-) methyltransferase domain containing 2 (RG9MTD2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC225499L4 Lenti ORF clone of Human RNA (guanine-9-) methyltransferase domain containing 2 (RG9MTD2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG225499 TRMT10A (tGFP-tagged) - Human RNA (guanine-9-) methyltransferase domain containing 2 (RG9MTD2), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.